Incidental Mutation 'R7012:Fhad1'
ID545066
Institutional Source Beutler Lab
Gene Symbol Fhad1
Ensembl Gene ENSMUSG00000051435
Gene Nameforkhead-associated (FHA) phosphopeptide binding domain 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R7012 (G1)
Quality Score200.468
Status Validated
Chromosome4
Chromosomal Location141890438-142015082 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) CGG to CG at 141918291 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000101406 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036701] [ENSMUST00000105779] [ENSMUST00000105780]
Predicted Effect probably null
Transcript: ENSMUST00000036701
SMART Domains Protein: ENSMUSP00000036224
Gene: ENSMUSG00000051435

DomainStartEndE-ValueType
coiled coil region 31 250 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000105779
SMART Domains Protein: ENSMUSP00000101405
Gene: ENSMUSG00000051435

DomainStartEndE-ValueType
FHA 17 69 8.41e-8 SMART
low complexity region 111 124 N/A INTRINSIC
coiled coil region 307 434 N/A INTRINSIC
coiled coil region 640 915 N/A INTRINSIC
low complexity region 1091 1102 N/A INTRINSIC
coiled coil region 1111 1140 N/A INTRINSIC
coiled coil region 1255 1339 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000105780
SMART Domains Protein: ENSMUSP00000101406
Gene: ENSMUSG00000051435

DomainStartEndE-ValueType
FHA 17 69 8.41e-8 SMART
low complexity region 111 124 N/A INTRINSIC
coiled coil region 307 434 N/A INTRINSIC
coiled coil region 640 915 N/A INTRINSIC
low complexity region 1091 1102 N/A INTRINSIC
coiled coil region 1111 1140 N/A INTRINSIC
coiled coil region 1255 1339 N/A INTRINSIC
Meta Mutation Damage Score 0.5824 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (49/49)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox3 T C 5: 35,612,087 F686L probably benign Het
Adcy4 C T 14: 55,779,919 V266I possibly damaging Het
Adgrb1 A G 15: 74,529,901 T249A probably damaging Het
Adssl1 A G 12: 112,634,236 D213G probably benign Het
Ap1b1 T G 11: 5,030,963 V453G probably damaging Het
Apold1 G A 6: 134,984,044 G154R probably damaging Het
Birc5 A G 11: 117,849,436 E29G probably benign Het
Clcn1 G A 6: 42,290,608 R75H probably benign Het
Cngb1 T A 8: 95,257,955 I868F possibly damaging Het
Cntn6 T A 6: 104,726,262 V215E probably damaging Het
Cntn6 A G 6: 104,774,480 I294V probably benign Het
Col6a2 A T 10: 76,614,677 I140N possibly damaging Het
Cops5 A G 1: 10,030,665 *147Q probably null Het
Dbr1 T A 9: 99,583,321 Y317* probably null Het
Dock5 A C 14: 67,822,586 V468G probably damaging Het
F13b A G 1: 139,516,358 I477V probably benign Het
Git1 T C 11: 77,499,780 L114P probably damaging Het
Greb1l G T 18: 10,529,707 probably null Het
Itih4 A G 14: 30,890,749 N244S probably benign Het
Lin28a A G 4: 134,018,729 S5P probably damaging Het
Lipt1 T C 1: 37,875,979 I372T probably benign Het
Lysmd4 A G 7: 67,226,017 T143A probably benign Het
Muc16 T C 9: 18,495,618 probably null Het
Olfr1101 A T 2: 86,988,707 H156Q possibly damaging Het
Olfr1393 A T 11: 49,280,996 M283L probably benign Het
Olfr271-ps1 A G 4: 52,936,193 L30P probably damaging Het
Olfr49 A G 14: 54,282,217 I226T possibly damaging Het
Pclo G A 5: 14,750,479 G4438D unknown Het
Phlpp2 T A 8: 109,876,854 F51I possibly damaging Het
Rab5c G A 11: 100,719,963 R40C probably damaging Het
Rxfp2 T C 5: 150,081,194 V711A probably benign Het
Sbno2 A T 10: 80,069,518 probably benign Het
Setd2 T A 9: 110,547,683 S189T probably damaging Het
Sez6 A G 11: 77,977,795 N965S probably benign Het
Sh3d19 A G 3: 86,085,013 N116S probably benign Het
Slc43a3 T C 2: 84,946,969 Y221H probably damaging Het
Slco1a6 T C 6: 142,086,561 I613V probably benign Het
Stag3 T A 5: 138,297,609 probably null Het
Ston1 T C 17: 88,635,985 M273T probably damaging Het
Tbc1d32 A T 10: 56,224,724 Y53N probably damaging Het
Tmem132b T A 5: 125,698,590 L376Q probably damaging Het
Trim60 A G 8: 65,000,391 V402A possibly damaging Het
Tssk5 A C 15: 76,373,545 N178K probably damaging Het
Ttll9 T C 2: 153,003,062 I450T possibly damaging Het
Tyw1 T G 5: 130,277,730 probably null Het
Usp16 T C 16: 87,458,744 probably null Het
Vmn2r97 T C 17: 18,947,494 V670A probably damaging Het
Vmn2r98 A G 17: 19,066,268 N343D probably benign Het
Zfp472 T G 17: 32,977,246 N98K probably benign Het
Other mutations in Fhad1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01065:Fhad1 APN 4 141905612 missense probably benign 0.02
IGL01478:Fhad1 APN 4 141951638 missense possibly damaging 0.84
IGL01752:Fhad1 APN 4 141972899 missense possibly damaging 0.82
IGL01788:Fhad1 APN 4 141932802 missense probably benign 0.00
IGL01919:Fhad1 APN 4 141964595 missense probably damaging 0.96
IGL02489:Fhad1 APN 4 141957620 missense probably damaging 0.97
IGL02568:Fhad1 APN 4 141932794 missense probably null 1.00
IGL02583:Fhad1 APN 4 142011644 utr 5 prime probably benign
IGL02716:Fhad1 APN 4 141918331 missense possibly damaging 0.89
IGL02819:Fhad1 APN 4 141918758 missense probably benign 0.23
IGL02820:Fhad1 APN 4 141918758 missense probably benign 0.23
IGL03038:Fhad1 APN 4 142002494 missense probably benign 0.38
IGL03167:Fhad1 APN 4 141972797 missense probably benign 0.00
IGL03255:Fhad1 APN 4 141972880 missense possibly damaging 0.79
PIT1430001:Fhad1 UTSW 4 141909749 missense probably damaging 0.99
R0014:Fhad1 UTSW 4 141928408 missense probably damaging 1.00
R0116:Fhad1 UTSW 4 141940095 missense probably benign 0.06
R0143:Fhad1 UTSW 4 141929646 splice site probably benign
R0178:Fhad1 UTSW 4 141955340 missense probably benign 0.31
R0308:Fhad1 UTSW 4 141985593 splice site probably benign
R0384:Fhad1 UTSW 4 142002426 missense probably benign
R0583:Fhad1 UTSW 4 141903990 missense probably benign 0.37
R1501:Fhad1 UTSW 4 141964625 missense probably benign
R1584:Fhad1 UTSW 4 141985511 missense probably benign 0.22
R1615:Fhad1 UTSW 4 141922323 missense probably damaging 0.99
R1991:Fhad1 UTSW 4 141982162 missense possibly damaging 0.75
R2060:Fhad1 UTSW 4 141899249 missense probably benign 0.08
R2079:Fhad1 UTSW 4 141991202 nonsense probably null
R2133:Fhad1 UTSW 4 141928400 missense probably damaging 1.00
R2337:Fhad1 UTSW 4 141922344 missense possibly damaging 0.84
R2843:Fhad1 UTSW 4 141904968 missense probably benign 0.06
R2844:Fhad1 UTSW 4 141904968 missense probably benign 0.06
R2845:Fhad1 UTSW 4 141904968 missense probably benign 0.06
R2846:Fhad1 UTSW 4 141904968 missense probably benign 0.06
R2866:Fhad1 UTSW 4 141920788 missense probably benign 0.00
R3119:Fhad1 UTSW 4 141918307 frame shift probably null
R3760:Fhad1 UTSW 4 141909813 missense probably damaging 1.00
R4180:Fhad1 UTSW 4 141985543 missense possibly damaging 0.69
R4466:Fhad1 UTSW 4 141957658 missense probably damaging 1.00
R4627:Fhad1 UTSW 4 141896468 missense possibly damaging 0.47
R4680:Fhad1 UTSW 4 142011547 nonsense probably null
R4725:Fhad1 UTSW 4 141928378 critical splice donor site probably null
R4755:Fhad1 UTSW 4 141928483 missense probably damaging 1.00
R4831:Fhad1 UTSW 4 141916067 splice site probably null
R4909:Fhad1 UTSW 4 141985511 missense probably benign 0.01
R4968:Fhad1 UTSW 4 141918307 missense probably damaging 1.00
R5004:Fhad1 UTSW 4 142002599 critical splice acceptor site probably null
R5036:Fhad1 UTSW 4 141920741 missense probably benign 0.03
R5048:Fhad1 UTSW 4 141964676 critical splice acceptor site probably null
R5416:Fhad1 UTSW 4 141918802 missense probably benign 0.39
R5504:Fhad1 UTSW 4 141985535 missense probably benign
R5586:Fhad1 UTSW 4 141905131 missense probably benign 0.44
R5692:Fhad1 UTSW 4 141963457 missense probably benign 0.00
R5706:Fhad1 UTSW 4 141954116 missense probably damaging 1.00
R5773:Fhad1 UTSW 4 141929570 missense probably damaging 0.99
R5823:Fhad1 UTSW 4 141955306 missense possibly damaging 0.84
R5833:Fhad1 UTSW 4 142002527 missense probably damaging 1.00
R6170:Fhad1 UTSW 4 141890952 nonsense probably null
R6286:Fhad1 UTSW 4 141920898 missense probably damaging 1.00
R6610:Fhad1 UTSW 4 141916396 missense possibly damaging 0.94
R6755:Fhad1 UTSW 4 141964604 missense probably damaging 1.00
R7006:Fhad1 UTSW 4 141918291 frame shift probably null
R7008:Fhad1 UTSW 4 141918291 frame shift probably null
R7014:Fhad1 UTSW 4 141918291 frame shift probably null
R7058:Fhad1 UTSW 4 141918291 frame shift probably null
R7059:Fhad1 UTSW 4 141918291 frame shift probably null
R7060:Fhad1 UTSW 4 141918291 frame shift probably null
R7159:Fhad1 UTSW 4 141951616 missense probably benign 0.01
X0018:Fhad1 UTSW 4 141951616 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGGTCCACCAAGTCTGTGTG -3'
(R):5'- TATTTAAAGGCCGCCTGTCCC -3'

Sequencing Primer
(F):5'- CAAGTCTGTGTGTTCCCCTGG -3'
(R):5'- TCCCTGGGCATTTTGAGC -3'
Posted On2019-05-13