Incidental Mutation 'R0609:Kit'
ID54511
Institutional Source Beutler Lab
Gene Symbol Kit
Ensembl Gene ENSMUSG00000005672
Gene NameKIT proto-oncogene receptor tyrosine kinase
SynonymsSCO5, Dominant white spotting, Tr-kit, belly-spot, CD117, Gsfsow3, Gsfsco5, SOW3, SCO1, Steel Factor Receptor, c-KIT, Gsfsco1
MMRRC Submission 038798-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.858) question?
Stock #R0609 (G1)
Quality Score211
Status Not validated
Chromosome5
Chromosomal Location75574916-75656722 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 75610879 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 232 (V232A)
Ref Sequence ENSEMBL: ENSMUSP00000116465 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005815] [ENSMUST00000144270]
Predicted Effect probably benign
Transcript: ENSMUST00000005815
AA Change: V232A

PolyPhen 2 Score 0.354 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000005815
Gene: ENSMUSG00000005672
AA Change: V232A

DomainStartEndE-ValueType
low complexity region 10 18 N/A INTRINSIC
low complexity region 25 38 N/A INTRINSIC
IG 43 113 3.02e0 SMART
IG_like 122 206 1.09e2 SMART
IGc2 225 300 3.79e-4 SMART
IG 323 413 1.21e-2 SMART
IG_like 429 501 1.88e0 SMART
transmembrane domain 524 546 N/A INTRINSIC
TyrKc 592 926 2.5e-138 SMART
low complexity region 945 963 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143221
Predicted Effect probably benign
Transcript: ENSMUST00000144270
AA Change: V232A

PolyPhen 2 Score 0.354 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000116465
Gene: ENSMUSG00000005672
AA Change: V232A

DomainStartEndE-ValueType
low complexity region 1 10 N/A INTRINSIC
low complexity region 22 30 N/A INTRINSIC
low complexity region 37 50 N/A INTRINSIC
IG 55 125 3.02e0 SMART
IG_like 134 218 1.09e2 SMART
IGc2 237 312 3.79e-4 SMART
IG 335 425 1.21e-2 SMART
IG_like 441 513 1.88e0 SMART
transmembrane domain 532 554 N/A INTRINSIC
TyrKc 600 934 2.5e-138 SMART
low complexity region 953 971 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: The c-Kit proto-oncogene is the cellular homolog of the transforming gene of a feline retrovirus (v-Kit). The c-kit protein includes characteristics of a protein kinase transmembrane receptor. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations at this locus affect migration of embryonic stem cell populations, resulting in mild to severe impairments in hematopoiesis, and pigmentation. Some alleles are homozygous lethal, sterile, or result in the formation of gastrointestinal tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930596D02Rik A T 14: 35,811,461 probably null Het
Abcb4 T A 5: 8,947,376 C952S probably damaging Het
Adamtsl2 A G 2: 27,089,635 D272G probably benign Het
Aim2 G A 1: 173,461,964 D158N probably damaging Het
Aldh3b1 C T 19: 3,914,024 R426H probably damaging Het
Apoc2 A G 7: 19,673,353 S28P probably benign Het
Arfgef3 G A 10: 18,597,431 T1628I probably benign Het
Atp10a G A 7: 58,819,740 probably null Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
Bmp8b T A 4: 123,121,899 D226E probably benign Het
Brsk2 T C 7: 141,998,492 Y618H probably damaging Het
Casp12 T A 9: 5,346,554 F27Y probably damaging Het
Casp8 T A 1: 58,844,792 N439K probably benign Het
Ccdc175 T A 12: 72,157,507 K253N probably benign Het
Cdc42bpa A G 1: 180,040,179 H193R probably damaging Het
Cdk17 T C 10: 93,216,472 M138T probably benign Het
Cdon C A 9: 35,478,611 P854T probably damaging Het
Cep44 A G 8: 56,544,152 M117T possibly damaging Het
Cep89 A T 7: 35,435,530 E674D probably damaging Het
Cit C T 5: 115,873,943 A203V probably damaging Het
Clstn1 C A 4: 149,629,300 probably null Het
Col7a1 T A 9: 108,958,147 D565E unknown Het
Cpb1 T A 3: 20,262,474 Y304F probably damaging Het
Cps1 T G 1: 67,172,802 Y710D probably damaging Het
Creb3l1 T C 2: 91,987,053 T372A possibly damaging Het
Dars A G 1: 128,405,381 V102A probably benign Het
Dhx35 C T 2: 158,817,415 T168I possibly damaging Het
Dnah5 T C 15: 28,327,779 S2100P probably benign Het
Dst T C 1: 34,266,960 probably null Het
Egflam A C 15: 7,253,523 L351R possibly damaging Het
Elp2 T A 18: 24,626,156 D523E probably benign Het
Exo5 C A 4: 120,921,684 G328V probably damaging Het
Fam208a C T 14: 27,461,750 T722I probably benign Het
Fut9 A G 4: 25,620,811 M1T probably null Het
Galnt5 A G 2: 58,024,625 N584S possibly damaging Het
Gbp3 T C 3: 142,567,772 V360A probably damaging Het
Gdf6 G A 4: 9,859,977 C353Y probably damaging Het
Gm13089 A T 4: 143,698,503 D123E probably benign Het
Hace1 A G 10: 45,648,869 T244A probably damaging Het
Hr T C 14: 70,559,657 I500T probably benign Het
Ifnl2 A T 7: 28,509,282 L115Q probably damaging Het
Iigp1 T C 18: 60,389,824 F5L probably benign Het
Inhbb A G 1: 119,417,416 L381P probably damaging Het
Irx3 A T 8: 91,801,093 S50T probably benign Het
Ivns1abp C T 1: 151,360,145 T363I probably benign Het
Izumo1 A T 7: 45,622,899 T35S probably benign Het
Kank4 A G 4: 98,777,105 S651P probably damaging Het
Klhl11 T C 11: 100,463,714 Y427C probably damaging Het
Laptm4b T A 15: 34,258,689 N36K probably damaging Het
Lrrk1 T C 7: 66,266,615 probably null Het
Mamdc4 G T 2: 25,564,193 Q1042K probably benign Het
Mical2 A G 7: 112,321,440 probably null Het
Ms4a3 C A 19: 11,631,361 V176F possibly damaging Het
Myo3a T C 2: 22,333,513 V427A probably benign Het
Myo3a A C 2: 22,396,299 E626D possibly damaging Het
Nckap5 A T 1: 126,027,288 L577* probably null Het
Ndufa5 A T 6: 24,519,249 D64E possibly damaging Het
Nedd4l T C 18: 65,208,461 Y874H probably damaging Het
Nynrin T C 14: 55,872,761 V1775A probably damaging Het
Olfr141 A G 2: 86,806,861 L46S probably damaging Het
Olfr292 T C 7: 86,694,876 V140A possibly damaging Het
Olfr694 A T 7: 106,688,998 H244Q probably damaging Het
Olfr735 T C 14: 50,345,926 Y172C probably damaging Het
Olfr823 G A 10: 130,112,580 S70F probably damaging Het
Oplah A G 15: 76,302,992 S570P probably benign Het
Osbpl11 C A 16: 33,234,444 Y632* probably null Het
Osbpl5 A T 7: 143,694,821 L668Q probably damaging Het
Pcdhb19 T C 18: 37,497,952 W267R probably benign Het
Pkhd1l1 A C 15: 44,467,424 S132R possibly damaging Het
Ptpn13 T A 5: 103,556,145 S1348T probably benign Het
Rc3h1 T A 1: 160,930,135 W8R probably damaging Het
Rgs3 T G 4: 62,625,936 V323G probably damaging Het
Rora T A 9: 69,361,869 M82K probably damaging Het
Rph3al T C 11: 75,908,969 I55V probably benign Het
Sag T C 1: 87,812,991 V45A probably damaging Het
Scn3a T C 2: 65,536,510 E56G probably damaging Het
Sec24c T G 14: 20,686,948 V324G probably damaging Het
Sptbn1 A G 11: 30,138,979 L761S probably damaging Het
Stard9 A T 2: 120,706,306 D4186V probably damaging Het
Stk39 T C 2: 68,366,167 E306G probably damaging Het
Sycp1 C A 3: 102,898,849 probably null Het
Taf2 A C 15: 55,060,050 L277R probably damaging Het
Tbc1d23 T A 16: 57,173,106 I566F possibly damaging Het
Tekt5 T C 16: 10,361,304 T400A possibly damaging Het
Tgfbrap1 T C 1: 43,060,141 H401R probably benign Het
Tie1 T A 4: 118,476,147 I841L possibly damaging Het
Tln1 T G 4: 43,544,645 T1095P possibly damaging Het
Tmem147 A G 7: 30,728,102 Y72H probably benign Het
Tnfaip2 A G 12: 111,453,507 N691S probably benign Het
Trim24 G A 6: 37,957,783 C845Y probably damaging Het
Trim30b T A 7: 104,357,976 probably benign Het
Trpc4 T G 3: 54,194,768 L29R probably damaging Het
Trpm6 A T 19: 18,825,862 I890F probably damaging Het
Ttc23l C T 15: 10,504,536 E442K probably benign Het
Uggt2 A G 14: 119,095,336 V62A probably damaging Het
Ugt1a6a C A 1: 88,138,884 S137R probably benign Het
Unc13a A G 8: 71,658,467 Y367H probably damaging Het
Vmn2r49 A G 7: 9,976,306 I833T probably benign Het
Vmn2r7 T C 3: 64,716,479 D231G probably benign Het
Ythdc2 A T 18: 44,864,357 M994L probably benign Het
Zcchc6 A T 13: 59,799,782 C908* probably null Het
Zfp804a G A 2: 82,257,588 S587N probably damaging Het
Zswim2 A G 2: 83,923,659 I219T probably benign Het
Other mutations in Kit
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00466:Kit APN 5 75610819 missense probably benign 0.00
IGL00834:Kit APN 5 75645959 missense probably damaging 1.00
IGL00846:Kit APN 5 75640811 missense probably damaging 0.98
IGL01149:Kit APN 5 75610876 missense probably damaging 0.97
IGL01341:Kit APN 5 75607074 missense probably damaging 1.00
IGL02004:Kit APN 5 75621014 missense probably benign
IGL02281:Kit APN 5 75654534 missense possibly damaging 0.66
IGL02424:Kit APN 5 75639106 missense probably benign
IGL02697:Kit APN 5 75607259 missense probably benign
IGL02929:Kit APN 5 75640769 missense probably damaging 1.00
IGL03053:Kit APN 5 75610914 missense probably benign
IGL03127:Kit APN 5 75641188 missense probably benign 0.44
IGL03174:Kit APN 5 75607113 missense probably benign
IGL03381:Kit APN 5 75607128 missense probably benign 0.04
Casper UTSW 5 75645875 missense probably damaging 1.00
pretty2 UTSW 5 75649550 missense probably damaging 1.00
IGL02837:Kit UTSW 5 75639008 missense probably benign 0.00
R0022:Kit UTSW 5 75622997 missense probably benign 0.00
R0022:Kit UTSW 5 75622997 missense probably benign 0.00
R0092:Kit UTSW 5 75647754 missense possibly damaging 0.93
R0254:Kit UTSW 5 75620921 missense probably benign
R0329:Kit UTSW 5 75652829 missense probably damaging 1.00
R1068:Kit UTSW 5 75609518 missense probably benign
R1115:Kit UTSW 5 75649532 splice site probably benign
R1480:Kit UTSW 5 75637317 missense probably benign 0.00
R1639:Kit UTSW 5 75652807 missense probably damaging 1.00
R1801:Kit UTSW 5 75648393 missense probably damaging 1.00
R1973:Kit UTSW 5 75615442 missense probably damaging 1.00
R2033:Kit UTSW 5 75637317 missense possibly damaging 0.88
R3125:Kit UTSW 5 75647827 missense probably benign 0.07
R3125:Kit UTSW 5 75647828 missense probably null 0.00
R3437:Kit UTSW 5 75645905 missense probably damaging 1.00
R3791:Kit UTSW 5 75639150 missense probably damaging 1.00
R3939:Kit UTSW 5 75609318 missense probably benign 0.00
R3940:Kit UTSW 5 75609318 missense probably benign 0.00
R3941:Kit UTSW 5 75609318 missense probably benign 0.00
R3942:Kit UTSW 5 75609318 missense probably benign 0.00
R4092:Kit UTSW 5 75610810 missense probably benign 0.28
R4376:Kit UTSW 5 75640499 missense probably benign 0.00
R4377:Kit UTSW 5 75640499 missense probably benign 0.00
R4668:Kit UTSW 5 75641220 splice site probably null
R5104:Kit UTSW 5 75615478 missense probably benign 0.00
R5152:Kit UTSW 5 75620847 missense probably benign 0.00
R5154:Kit UTSW 5 75640540 missense probably damaging 0.99
R5508:Kit UTSW 5 75649548 missense probably damaging 1.00
R5624:Kit UTSW 5 75609394 missense probably benign 0.40
R5731:Kit UTSW 5 75654415 missense possibly damaging 0.93
R6270:Kit UTSW 5 75609509 missense probably benign
R6565:Kit UTSW 5 75645853 missense probably damaging 1.00
R6694:Kit UTSW 5 75640757 missense possibly damaging 0.94
R6805:Kit UTSW 5 75652808 missense probably damaging 1.00
R6823:Kit UTSW 5 75652649 missense probably benign 0.01
R6848:Kit UTSW 5 75607212 missense probably benign
U24488:Kit UTSW 5 75623014 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGAAAGCCAGGAGTGTTCATGATCTC -3'
(R):5'- CTAACAGCTATGACTGCCAGCAGG -3'

Sequencing Primer
(F):5'- gcttgctgcttgctcttc -3'
(R):5'- ACTGCCAGCAGGGTCAC -3'
Posted OnJul 11, 2013