Incidental Mutation 'R7013:Orc5'
ID545119
Institutional Source Beutler Lab
Gene Symbol Orc5
Ensembl Gene ENSMUSG00000029012
Gene Nameorigin recognition complex, subunit 5
SynonymsMmORC5, mouse origin recognition complex 5, Orc5l
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.943) question?
Stock #R7013 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location22486485-22550429 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 22533789 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 158 (V158A)
Ref Sequence ENSEMBL: ENSMUSP00000120214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030872] [ENSMUST00000141263]
Predicted Effect probably benign
Transcript: ENSMUST00000030872
AA Change: V176A

PolyPhen 2 Score 0.097 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000030872
Gene: ENSMUSG00000029012
AA Change: V176A

DomainStartEndE-ValueType
Pfam:AAA_16 7 155 2.4e-15 PFAM
Pfam:AAA_22 28 160 2.9e-9 PFAM
Pfam:ORC5_C 177 431 5.1e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141263
AA Change: V158A

PolyPhen 2 Score 0.161 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000120214
Gene: ENSMUSG00000029012
AA Change: V158A

DomainStartEndE-ValueType
Pfam:AAA_16 3 137 2.6e-9 PFAM
Pfam:AAA_22 11 144 1.1e-9 PFAM
Pfam:ORC5_C 159 312 2.7e-51 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The origin recognition complex (ORC) is a highly conserved six subunit protein complex essential for the initiation of the DNA replication in eukaryotic cells. Studies in yeast demonstrated that ORC binds specifically to origins of replication and serves as a platform for the assembly of additional initiation factors such as Cdc6 and Mcm proteins. The protein encoded by this gene is a subunit of the ORC complex. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Oct 2010]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A G 6: 121,641,386 I213V probably null Het
Abcc4 A T 14: 118,526,343 C952S probably benign Het
Adhfe1 T C 1: 9,550,591 probably benign Het
Apob T A 12: 8,010,080 L2854* probably null Het
Arhgap5 T A 12: 52,518,326 N693K probably benign Het
Arid5b A G 10: 68,097,819 V508A probably damaging Het
Atl1 A G 12: 69,953,440 E288G probably damaging Het
Bank1 A G 3: 136,100,509 S455P possibly damaging Het
Ces1c A T 8: 93,130,764 L63Q probably damaging Het
Crmp1 A T 5: 37,268,692 probably null Het
Csnka2ip T C 16: 64,478,417 D528G unknown Het
Dact2 T C 17: 14,203,534 T66A probably benign Het
Dkk2 T C 3: 132,174,999 L135P probably damaging Het
Drc3 A G 11: 60,387,303 N381S probably benign Het
Dsg4 T C 18: 20,458,521 V439A possibly damaging Het
Dysf C T 6: 84,137,358 P1240S probably damaging Het
Esyt1 A T 10: 128,525,651 V58E probably damaging Het
Exo1 G T 1: 175,893,772 A326S probably damaging Het
Fam20b A G 1: 156,690,565 S220P probably damaging Het
Fmo6 G A 1: 162,918,248 T402I probably benign Het
Galnt10 A T 11: 57,765,584 D198V probably benign Het
Gm17689 C A 9: 36,582,558 W26C unknown Het
Gsap A T 5: 21,278,110 E604D probably benign Het
Il20rb A G 9: 100,461,428 Y258H probably benign Het
Impg1 A T 9: 80,378,494 S409R probably damaging Het
Jak3 G T 8: 71,678,781 V97F possibly damaging Het
Lbhd1 T C 19: 8,884,159 S52P probably damaging Het
Lman2l A G 1: 36,443,518 probably benign Het
Lnpep C A 17: 17,568,363 M493I probably benign Het
Mpp4 T C 1: 59,149,615 D132G probably damaging Het
Nlrp1a G A 11: 71,123,552 R291W probably benign Het
Olfr1252 T A 2: 89,721,386 I242F probably benign Het
Olfr1309 G A 2: 111,983,963 A37V probably benign Het
Olfr142 C T 2: 90,252,097 R297Q possibly damaging Het
Olfr382 G T 11: 73,516,421 Y259* probably null Het
Olfr733 T A 14: 50,299,199 I37F probably damaging Het
Pcdhga3 A G 18: 37,675,621 N376D probably damaging Het
Ptprr T A 10: 116,236,754 I207N probably damaging Het
Recql5 A G 11: 115,894,576 V698A probably benign Het
Rnf212 A T 5: 108,729,960 M222K probably benign Het
Rsph6a A G 7: 19,054,895 S51G probably benign Het
Smap2 T C 4: 120,982,168 K121E probably damaging Het
Syt11 A T 3: 88,747,989 V335D possibly damaging Het
Terb1 A T 8: 104,488,590 C251* probably null Het
Tmprss11d C A 5: 86,326,573 R37L probably damaging Het
Ttbk2 T C 2: 120,745,784 N904S possibly damaging Het
Vmn1r119 T A 7: 21,011,789 I223F probably damaging Het
Vmn1r66 T C 7: 10,274,756 R117G possibly damaging Het
Zfp106 T C 2: 120,531,632 D1025G probably damaging Het
Other mutations in Orc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Orc5 APN 5 22523539 missense probably damaging 0.99
IGL00488:Orc5 APN 5 22516773 missense probably damaging 0.99
IGL01915:Orc5 APN 5 22522383 unclassified probably benign
IGL02385:Orc5 APN 5 22526440 missense probably damaging 1.00
IGL02830:Orc5 APN 5 22529267 missense probably damaging 1.00
IGL03128:Orc5 APN 5 22516773 missense probably damaging 0.99
R0372:Orc5 UTSW 5 22533784 missense possibly damaging 0.91
R0446:Orc5 UTSW 5 22546457 missense probably benign 0.19
R2060:Orc5 UTSW 5 22516703 critical splice donor site probably null
R2144:Orc5 UTSW 5 22547927 missense possibly damaging 0.94
R2375:Orc5 UTSW 5 22546552 missense probably damaging 1.00
R3875:Orc5 UTSW 5 22537566 missense probably benign 0.00
R4620:Orc5 UTSW 5 22529176 missense probably damaging 1.00
R4625:Orc5 UTSW 5 22548005 missense probably benign
R4626:Orc5 UTSW 5 22548005 missense probably benign
R4627:Orc5 UTSW 5 22548005 missense probably benign
R4629:Orc5 UTSW 5 22548005 missense probably benign
R4664:Orc5 UTSW 5 22546522 missense probably benign
R5751:Orc5 UTSW 5 22499971 splice site probably null
R5758:Orc5 UTSW 5 22529258 missense possibly damaging 0.81
R7326:Orc5 UTSW 5 22523584 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- TCCCTTCACAGTTGTAAAATGCAG -3'
(R):5'- AAATGGTTGAGCTCTCTGATTAGG -3'

Sequencing Primer
(F):5'- CAGTTGTAAAATGCAGAAATAGAAGC -3'
(R):5'- TTAAGCTTTGCTGAATTTAGTTGAAG -3'
Posted On2019-05-13