Incidental Mutation 'R7013:Drc3'
ID545137
Institutional Source Beutler Lab
Gene Symbol Drc3
Ensembl Gene ENSMUSG00000056598
Gene Namedynein regulatory complex subunit 3
Synonyms4930449E07Rik, Lrrc48, m6Bei
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #R7013 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location60353329-60394341 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 60387303 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 381 (N381S)
Ref Sequence ENSEMBL: ENSMUSP00000104363 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108722] [ENSMUST00000108723]
Predicted Effect probably benign
Transcript: ENSMUST00000108722
AA Change: N381S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000104362
Gene: ENSMUSG00000056598
AA Change: N381S

DomainStartEndE-ValueType
low complexity region 66 75 N/A INTRINSIC
LRR 86 106 9.24e1 SMART
LRR 108 129 1.71e1 SMART
LRR 130 153 1.49e1 SMART
low complexity region 216 235 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108723
AA Change: N381S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000104363
Gene: ENSMUSG00000056598
AA Change: N381S

DomainStartEndE-ValueType
low complexity region 66 75 N/A INTRINSIC
LRR 86 106 9.24e1 SMART
LRR 108 129 1.71e1 SMART
LRR 130 153 1.49e1 SMART
low complexity region 216 235 N/A INTRINSIC
Meta Mutation Damage Score 0.096 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (47/47)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A G 6: 121,641,386 I213V probably null Het
Abcc4 A T 14: 118,526,343 C952S probably benign Het
Adhfe1 T C 1: 9,550,591 probably benign Het
Apob T A 12: 8,010,080 L2854* probably null Het
Arhgap5 T A 12: 52,518,326 N693K probably benign Het
Arid5b A G 10: 68,097,819 V508A probably damaging Het
Atl1 A G 12: 69,953,440 E288G probably damaging Het
Bank1 A G 3: 136,100,509 S455P possibly damaging Het
Ces1c A T 8: 93,130,764 L63Q probably damaging Het
Crmp1 A T 5: 37,268,692 probably null Het
Csnka2ip T C 16: 64,478,417 D528G unknown Het
Dact2 T C 17: 14,203,534 T66A probably benign Het
Dkk2 T C 3: 132,174,999 L135P probably damaging Het
Dsg4 T C 18: 20,458,521 V439A possibly damaging Het
Dysf C T 6: 84,137,358 P1240S probably damaging Het
Esyt1 A T 10: 128,525,651 V58E probably damaging Het
Exo1 G T 1: 175,893,772 A326S probably damaging Het
Fam20b A G 1: 156,690,565 S220P probably damaging Het
Fmo6 G A 1: 162,918,248 T402I probably benign Het
Galnt10 A T 11: 57,765,584 D198V probably benign Het
Gm17689 C A 9: 36,582,558 W26C unknown Het
Gsap A T 5: 21,278,110 E604D probably benign Het
Il20rb A G 9: 100,461,428 Y258H probably benign Het
Impg1 A T 9: 80,378,494 S409R probably damaging Het
Jak3 G T 8: 71,678,781 V97F possibly damaging Het
Lbhd1 T C 19: 8,884,159 S52P probably damaging Het
Lman2l A G 1: 36,443,518 probably benign Het
Lnpep C A 17: 17,568,363 M493I probably benign Het
Mpp4 T C 1: 59,149,615 D132G probably damaging Het
Nlrp1a G A 11: 71,123,552 R291W probably benign Het
Olfr1252 T A 2: 89,721,386 I242F probably benign Het
Olfr1309 G A 2: 111,983,963 A37V probably benign Het
Olfr142 C T 2: 90,252,097 R297Q possibly damaging Het
Olfr382 G T 11: 73,516,421 Y259* probably null Het
Olfr733 T A 14: 50,299,199 I37F probably damaging Het
Orc5 A G 5: 22,533,789 V158A probably benign Het
Pcdhga3 A G 18: 37,675,621 N376D probably damaging Het
Ptprr T A 10: 116,236,754 I207N probably damaging Het
Recql5 A G 11: 115,894,576 V698A probably benign Het
Rnf212 A T 5: 108,729,960 M222K probably benign Het
Rsph6a A G 7: 19,054,895 S51G probably benign Het
Smap2 T C 4: 120,982,168 K121E probably damaging Het
Syt11 A T 3: 88,747,989 V335D possibly damaging Het
Terb1 A T 8: 104,488,590 C251* probably null Het
Tmprss11d C A 5: 86,326,573 R37L probably damaging Het
Ttbk2 T C 2: 120,745,784 N904S possibly damaging Het
Vmn1r119 T A 7: 21,011,789 I223F probably damaging Het
Vmn1r66 T C 7: 10,274,756 R117G possibly damaging Het
Zfp106 T C 2: 120,531,632 D1025G probably damaging Het
Other mutations in Drc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01319:Drc3 APN 11 60364962 missense probably null 0.70
IGL01457:Drc3 APN 11 60358649 utr 5 prime probably benign
IGL02329:Drc3 APN 11 60370578 missense probably damaging 1.00
IGL02576:Drc3 APN 11 60370551 missense probably benign 0.01
IGL02610:Drc3 APN 11 60370593 missense probably benign 0.40
IGL02817:Drc3 APN 11 60384236 missense probably benign 0.16
IGL03380:Drc3 APN 11 60377905 missense probably benign 0.01
R0020:Drc3 UTSW 11 60370545 missense probably damaging 1.00
R1221:Drc3 UTSW 11 60384226 missense probably benign
R1394:Drc3 UTSW 11 60393719 missense possibly damaging 0.94
R1483:Drc3 UTSW 11 60388889 missense probably benign 0.00
R2093:Drc3 UTSW 11 60370484 missense probably damaging 1.00
R2151:Drc3 UTSW 11 60375157 missense probably benign 0.15
R4631:Drc3 UTSW 11 60364908 missense probably benign 0.02
R4796:Drc3 UTSW 11 60363528 missense probably damaging 1.00
R4841:Drc3 UTSW 11 60370535 missense probably benign 0.00
R4842:Drc3 UTSW 11 60370535 missense probably benign 0.00
R5739:Drc3 UTSW 11 60375130 missense possibly damaging 0.89
R5766:Drc3 UTSW 11 60393821 missense probably benign 0.18
R6143:Drc3 UTSW 11 60370580 missense possibly damaging 0.82
R6298:Drc3 UTSW 11 60393770 missense possibly damaging 0.74
R6558:Drc3 UTSW 11 60364892 missense probably damaging 1.00
R6611:Drc3 UTSW 11 60364947 missense probably damaging 0.99
R6938:Drc3 UTSW 11 60394123 critical splice acceptor site probably null
R7108:Drc3 UTSW 11 60370554 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- CCCTACAAAGGCAAGGAGTCTG -3'
(R):5'- AAAAGCCTAGGCACCTCTG -3'

Sequencing Primer
(F):5'- TTTAATCCCAGCACTCGGGAG -3'
(R):5'- TAGGCACCTCTGCGTTAGCTG -3'
Posted On2019-05-13