Incidental Mutation 'R7013:Lbhd1'
ID545151
Institutional Source Beutler Lab
Gene Symbol Lbhd1
Ensembl Gene ENSMUSG00000096740
Gene NameLBH domain containing 1
SynonymsGm21743
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R7013 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location8883732-8892627 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 8884159 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 52 (S52P)
Ref Sequence ENSEMBL: ENSMUSP00000139692 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096251] [ENSMUST00000096253] [ENSMUST00000177826] [ENSMUST00000185488] [ENSMUST00000187504] [ENSMUST00000191089]
Predicted Effect probably benign
Transcript: ENSMUST00000096251
SMART Domains Protein: ENSMUSP00000093970
Gene: ENSMUSG00000071653

DomainStartEndE-ValueType
low complexity region 15 37 N/A INTRINSIC
low complexity region 99 112 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000096253
SMART Domains Protein: ENSMUSP00000093972
Gene: ENSMUSG00000071654

DomainStartEndE-ValueType
Pfam:DUF4574 1 84 1.3e-42 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000177826
AA Change: S52P

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000137432
Gene: ENSMUSG00000116166
AA Change: S52P

DomainStartEndE-ValueType
Pfam:Lbh 1 101 1.6e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000185488
SMART Domains Protein: ENSMUSP00000140221
Gene: ENSMUSG00000071653

DomainStartEndE-ValueType
low complexity region 15 37 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000187504
AA Change: S52P

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000139692
Gene: ENSMUSG00000096740
AA Change: S52P

DomainStartEndE-ValueType
Pfam:Lbh 1 101 2.5e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000191089
SMART Domains Protein: ENSMUSP00000140564
Gene: ENSMUSG00000116347

DomainStartEndE-ValueType
low complexity region 15 37 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (47/47)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A G 6: 121,641,386 I213V probably null Het
Abcc4 A T 14: 118,526,343 C952S probably benign Het
Adhfe1 T C 1: 9,550,591 probably benign Het
Apob T A 12: 8,010,080 L2854* probably null Het
Arhgap5 T A 12: 52,518,326 N693K probably benign Het
Arid5b A G 10: 68,097,819 V508A probably damaging Het
Atl1 A G 12: 69,953,440 E288G probably damaging Het
Bank1 A G 3: 136,100,509 S455P possibly damaging Het
Ces1c A T 8: 93,130,764 L63Q probably damaging Het
Crmp1 A T 5: 37,268,692 probably null Het
Csnka2ip T C 16: 64,478,417 D528G unknown Het
Dact2 T C 17: 14,203,534 T66A probably benign Het
Dkk2 T C 3: 132,174,999 L135P probably damaging Het
Drc3 A G 11: 60,387,303 N381S probably benign Het
Dsg4 T C 18: 20,458,521 V439A possibly damaging Het
Dysf C T 6: 84,137,358 P1240S probably damaging Het
Esyt1 A T 10: 128,525,651 V58E probably damaging Het
Exo1 G T 1: 175,893,772 A326S probably damaging Het
Fam20b A G 1: 156,690,565 S220P probably damaging Het
Fmo6 G A 1: 162,918,248 T402I probably benign Het
Galnt10 A T 11: 57,765,584 D198V probably benign Het
Gm17689 C A 9: 36,582,558 W26C unknown Het
Gsap A T 5: 21,278,110 E604D probably benign Het
Il20rb A G 9: 100,461,428 Y258H probably benign Het
Impg1 A T 9: 80,378,494 S409R probably damaging Het
Jak3 G T 8: 71,678,781 V97F possibly damaging Het
Lman2l A G 1: 36,443,518 probably benign Het
Lnpep C A 17: 17,568,363 M493I probably benign Het
Mpp4 T C 1: 59,149,615 D132G probably damaging Het
Nlrp1a G A 11: 71,123,552 R291W probably benign Het
Olfr1252 T A 2: 89,721,386 I242F probably benign Het
Olfr1309 G A 2: 111,983,963 A37V probably benign Het
Olfr142 C T 2: 90,252,097 R297Q possibly damaging Het
Olfr382 G T 11: 73,516,421 Y259* probably null Het
Olfr733 T A 14: 50,299,199 I37F probably damaging Het
Orc5 A G 5: 22,533,789 V158A probably benign Het
Pcdhga3 A G 18: 37,675,621 N376D probably damaging Het
Ptprr T A 10: 116,236,754 I207N probably damaging Het
Recql5 A G 11: 115,894,576 V698A probably benign Het
Rnf212 A T 5: 108,729,960 M222K probably benign Het
Rsph6a A G 7: 19,054,895 S51G probably benign Het
Smap2 T C 4: 120,982,168 K121E probably damaging Het
Syt11 A T 3: 88,747,989 V335D possibly damaging Het
Terb1 A T 8: 104,488,590 C251* probably null Het
Tmprss11d C A 5: 86,326,573 R37L probably damaging Het
Ttbk2 T C 2: 120,745,784 N904S possibly damaging Het
Vmn1r119 T A 7: 21,011,789 I223F probably damaging Het
Vmn1r66 T C 7: 10,274,756 R117G possibly damaging Het
Zfp106 T C 2: 120,531,632 D1025G probably damaging Het
Other mutations in Lbhd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R3834:Lbhd1 UTSW 19 8884057 missense probably benign
R4645:Lbhd1 UTSW 19 8884088 unclassified probably benign
R4812:Lbhd1 UTSW 19 8889174 missense probably damaging 0.99
R5257:Lbhd1 UTSW 19 8884089 unclassified probably benign
R5258:Lbhd1 UTSW 19 8884089 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TCCATGGCATCCAGAAAGTCC -3'
(R):5'- ATTCCTGGACATCTATTGTGGGTC -3'

Sequencing Primer
(F):5'- TGGCATCCAGAAAGTCCTCAGTTG -3'
(R):5'- TGTCAATGGCCTGAACGAATC -3'
Posted On2019-05-13