Incidental Mutation 'R7014:Rabgap1l'
ID545153
Institutional Source Beutler Lab
Gene Symbol Rabgap1l
Ensembl Gene ENSMUSG00000026721
Gene NameRAB GTPase activating protein 1-like
SynonymsHh1, 8430421H08Rik, 5830411O09Rik, 9630005B12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7014 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location160219174-160793211 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 160342072 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 60 (N60K)
Ref Sequence ENSEMBL: ENSMUSP00000141357 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028049] [ENSMUST00000028052] [ENSMUST00000191651]
Predicted Effect probably damaging
Transcript: ENSMUST00000028049
AA Change: N768K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028049
Gene: ENSMUSG00000026721
AA Change: N768K

DomainStartEndE-ValueType
low complexity region 113 124 N/A INTRINSIC
PTB 127 260 4.47e-20 SMART
Pfam:DUF3694 290 421 8.1e-41 PFAM
low complexity region 483 496 N/A INTRINSIC
TBC 535 747 5.13e-67 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000028052
AA Change: N87K

PolyPhen 2 Score 0.784 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000028052
Gene: ENSMUSG00000026721
AA Change: N87K

DomainStartEndE-ValueType
Blast:TBC 54 100 8e-16 BLAST
PDB:3HZJ|C 54 130 9e-35 PDB
Blast:TBC 113 176 2e-24 BLAST
low complexity region 188 200 N/A INTRINSIC
coiled coil region 281 340 N/A INTRINSIC
low complexity region 355 366 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000191651
AA Change: N60K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141357
Gene: ENSMUSG00000026721
AA Change: N60K

DomainStartEndE-ValueType
PDB:3HZJ|C 1 107 1e-71 PDB
SCOP:d1fkma2 1 107 1e-9 SMART
Blast:TBC 13 89 2e-32 BLAST
Meta Mutation Damage Score 0.188 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 99% (80/81)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap insertion are viable, fertile and overtly normal with no alterations in hematopoietic progenitor cell numbers or types. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik C T 7: 27,578,773 Q156* probably null Het
2700097O09Rik A G 12: 55,045,942 I264T probably benign Het
Arid3a G T 10: 79,950,884 M488I possibly damaging Het
Auts2 A G 5: 131,466,123 F331S probably damaging Het
Axdnd1 T C 1: 156,330,962 probably null Het
Bpifb5 C A 2: 154,224,956 S43* probably null Het
Carhsp1 A G 16: 8,661,005 V128A probably benign Het
Ccdc141 A G 2: 77,132,297 V101A probably damaging Het
Cdk6 C G 5: 3,473,152 L191V probably damaging Het
Cgnl1 T G 9: 71,725,134 K312Q possibly damaging Het
Col6a1 T C 10: 76,721,443 E225G probably damaging Het
Copg1 T A 6: 87,902,340 L456Q probably damaging Het
Ctif T A 18: 75,437,208 D540V possibly damaging Het
Cyfip1 T C 7: 55,919,493 I917T probably benign Het
Cyth1 T C 11: 118,212,651 D9G probably benign Het
Dnajb1 T C 8: 83,610,255 I118T probably damaging Het
Ebna1bp2 T A 4: 118,623,378 Y139* probably null Het
Fam162a A T 16: 36,049,932 V59E probably damaging Het
Fam213a T C 14: 41,002,494 E71G probably benign Het
Fhad1 CGG CG 4: 141,918,291 probably null Het
Fmo6 C G 1: 162,926,308 R112T probably benign Het
Gm11639 A G 11: 104,693,422 T100A probably benign Het
Gm17087 T A 17: 8,566,472 D133V probably benign Het
Gm17689 C A 9: 36,582,558 W26C unknown Het
Gm21994 A T 2: 150,255,262 C82* probably null Het
Gm42669 A G 5: 107,508,276 I802V probably benign Het
Gp2 T C 7: 119,451,645 N288D probably damaging Het
Gstm7 C T 3: 107,926,962 D196N probably benign Het
Hsph1 A T 5: 149,630,400 V201D probably damaging Het
Il20ra T C 10: 19,712,710 L26P unknown Het
Itpr1 T A 6: 108,431,498 probably null Het
Kcns3 A T 12: 11,091,687 I337N probably damaging Het
Kdm4d A G 9: 14,464,179 Y128H probably damaging Het
Kirrel2 A G 7: 30,454,574 I200T probably benign Het
Klhdc10 T A 6: 30,450,503 I294N probably damaging Het
Map1a A C 2: 121,300,239 N512T probably damaging Het
March8 C G 6: 116,403,543 C118W probably damaging Het
March8 T G 6: 116,403,544 C119G probably damaging Het
Mrpl38 G T 11: 116,134,915 P195Q probably damaging Het
Ms4a4d A T 19: 11,548,583 Q27L probably benign Het
Muc16 T A 9: 18,658,236 T996S unknown Het
Mug1 C T 6: 121,861,125 A438V probably benign Het
Mup7 T A 4: 60,069,866 I33F probably damaging Het
Ndufa5 C T 6: 24,519,191 probably null Het
Olfr1133 A T 2: 87,645,976 L49Q probably damaging Het
Olfr1141 T C 2: 87,753,871 I41V probably benign Het
Olfr1535 A G 13: 21,555,938 F28S probably benign Het
Olfr167 A T 16: 19,515,456 F60Y probably benign Het
Olfr873 T A 9: 20,300,663 C154* probably null Het
Parp9 T A 16: 35,960,063 probably null Het
Pbx1 T A 1: 168,431,380 D42V probably damaging Het
Pde4dip G T 3: 97,715,422 N1490K possibly damaging Het
Pdzd2 T C 15: 12,372,561 N2496S probably benign Het
Pdzd2 A G 15: 12,372,975 M2358T probably benign Het
Pglyrp2 C A 17: 32,415,930 C486F probably damaging Het
Pi4ka A G 16: 17,297,067 probably benign Het
Pknox2 T A 9: 36,909,667 T300S probably damaging Het
Plekhm3 A G 1: 64,883,270 I582T probably damaging Het
Prtg T C 9: 72,891,985 Y766H possibly damaging Het
Rabgap1 A G 2: 37,560,563 E901G probably benign Het
Rnf150 C T 8: 83,042,663 T359I probably benign Het
Rps6ka2 C T 17: 7,255,932 H236Y probably benign Het
Rrp1b T A 17: 32,049,427 L120Q probably damaging Het
Scn7a C A 2: 66,741,959 G223C probably null Het
Sema6a T A 18: 47,298,217 N138I probably damaging Het
Sept5 T A 16: 18,624,909 I97F probably damaging Het
Shcbp1 T A 8: 4,754,234 E225D probably damaging Het
Slc25a19 A G 11: 115,620,966 C124R probably damaging Het
Slc37a2 C T 9: 37,233,887 A428T probably damaging Het
Slc5a12 A G 2: 110,644,364 I538V probably benign Het
Slco4c1 A T 1: 96,823,781 probably null Het
Smarcad1 T C 6: 65,052,670 S81P probably damaging Het
Smyd1 T C 6: 71,238,627 D116G probably damaging Het
Themis T C 10: 28,789,707 Y589H probably benign Het
Trim30d T C 7: 104,483,336 K248R probably benign Het
Tspan12 C T 6: 21,772,919 M210I probably benign Het
Vmn2r11 T C 5: 109,053,423 Y405C probably damaging Het
Wdfy3 A G 5: 101,894,909 probably null Het
Wiz C A 17: 32,361,866 A83S probably damaging Het
Zmym6 T A 4: 127,123,544 Y947* probably null Het
Other mutations in Rabgap1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01095:Rabgap1l APN 1 160738969 missense probably benign 0.02
IGL01309:Rabgap1l APN 1 160700798 missense probably benign 0.00
IGL01448:Rabgap1l APN 1 160740745 splice site probably benign
IGL01886:Rabgap1l APN 1 160342042 missense probably damaging 1.00
IGL02010:Rabgap1l APN 1 160472071 missense probably damaging 0.99
IGL02079:Rabgap1l APN 1 160738970 missense probably benign 0.00
IGL02800:Rabgap1l APN 1 160472053 missense possibly damaging 0.73
IGL03343:Rabgap1l APN 1 160443283 missense probably benign
IGL03388:Rabgap1l APN 1 160733523 splice site probably null
IGL03406:Rabgap1l APN 1 160722169 missense probably damaging 1.00
R0047:Rabgap1l UTSW 1 160231789 splice site probably benign
R0047:Rabgap1l UTSW 1 160231789 splice site probably benign
R0048:Rabgap1l UTSW 1 160627369 splice site probably benign
R0099:Rabgap1l UTSW 1 160682116 missense possibly damaging 0.89
R0201:Rabgap1l UTSW 1 160453745 splice site probably benign
R0432:Rabgap1l UTSW 1 160722205 missense probably benign 0.10
R1104:Rabgap1l UTSW 1 160231875 splice site probably benign
R1220:Rabgap1l UTSW 1 160738909 missense probably damaging 1.00
R1485:Rabgap1l UTSW 1 160733680 missense probably benign 0.06
R1569:Rabgap1l UTSW 1 160702390 missense probably benign 0.08
R1907:Rabgap1l UTSW 1 160645310 missense probably benign 0.07
R2128:Rabgap1l UTSW 1 160738957 missense probably benign 0.00
R2129:Rabgap1l UTSW 1 160738957 missense probably benign 0.00
R2177:Rabgap1l UTSW 1 160724062 missense possibly damaging 0.89
R4636:Rabgap1l UTSW 1 160342090 synonymous probably null
R4722:Rabgap1l UTSW 1 160342164 missense possibly damaging 0.81
R4743:Rabgap1l UTSW 1 160453783 missense probably damaging 1.00
R4913:Rabgap1l UTSW 1 160238541 missense probably damaging 1.00
R4915:Rabgap1l UTSW 1 160441842 missense probably benign 0.01
R5035:Rabgap1l UTSW 1 160724036 missense probably damaging 1.00
R5087:Rabgap1l UTSW 1 160722239 missense probably damaging 1.00
R5437:Rabgap1l UTSW 1 160722147 missense probably damaging 1.00
R5507:Rabgap1l UTSW 1 160351328 missense possibly damaging 0.83
R5619:Rabgap1l UTSW 1 160238572 missense probably benign 0.00
R5691:Rabgap1l UTSW 1 160735684 missense probably damaging 1.00
R5837:Rabgap1l UTSW 1 160307222 utr 3 prime probably benign
R5881:Rabgap1l UTSW 1 160342113 missense probably damaging 1.00
R6045:Rabgap1l UTSW 1 160645323 missense probably benign 0.00
R6243:Rabgap1l UTSW 1 160645307 critical splice donor site probably null
R6294:Rabgap1l UTSW 1 160231849 missense probably benign 0.14
R6452:Rabgap1l UTSW 1 160453761 missense probably damaging 1.00
R6802:Rabgap1l UTSW 1 160733680 missense probably benign 0.06
R6945:Rabgap1l UTSW 1 160682182 missense probably benign 0.29
R7062:Rabgap1l UTSW 1 160226650 missense probably benign
R7089:Rabgap1l UTSW 1 160724172 nonsense probably null
R7170:Rabgap1l UTSW 1 160645365 missense probably damaging 1.00
R7172:Rabgap1l UTSW 1 160733586 missense probably benign 0.05
R7303:Rabgap1l UTSW 1 160682097 missense probably benign 0.01
R7357:Rabgap1l UTSW 1 160342038 missense probably damaging 1.00
R7466:Rabgap1l UTSW 1 160226484 critical splice donor site probably null
R7501:Rabgap1l UTSW 1 160700788 missense probably damaging 0.98
R7565:Rabgap1l UTSW 1 160251417 missense
Predicted Primers PCR Primer
(F):5'- CTGGAATGGTGAAGTCTAGGCG -3'
(R):5'- TGCAGGGATCCATTATTATAGTCTCC -3'

Sequencing Primer
(F):5'- TCTAGGCGAGAAGAGTGTGTACAC -3'
(R):5'- AGGATTTATTTCTGTATGTCTCATGC -3'
Posted On2019-05-13