Incidental Mutation 'R7014:Rabgap1'
ID545155
Institutional Source Beutler Lab
Gene Symbol Rabgap1
Ensembl Gene ENSMUSG00000035437
Gene NameRAB GTPase activating protein 1
SynonymsGapcena
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.455) question?
Stock #R7014 (G1)
Quality Score210.009
Status Not validated
Chromosome2
Chromosomal Location37443279-37566454 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37560563 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 901 (E901G)
Ref Sequence ENSEMBL: ENSMUSP00000108542 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061179] [ENSMUST00000112920] [ENSMUST00000183690]
Predicted Effect probably benign
Transcript: ENSMUST00000061179
AA Change: E901G

PolyPhen 2 Score 0.082 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000061624
Gene: ENSMUSG00000035437
AA Change: E901G

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
PTB 138 271 2.99e-30 SMART
Pfam:DUF3694 301 433 1.1e-38 PFAM
low complexity region 449 460 N/A INTRINSIC
low complexity region 473 481 N/A INTRINSIC
low complexity region 502 516 N/A INTRINSIC
TBC 558 770 9.27e-74 SMART
Blast:TBC 803 880 9e-33 BLAST
coiled coil region 986 1038 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112920
AA Change: E901G

PolyPhen 2 Score 0.082 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000108542
Gene: ENSMUSG00000035437
AA Change: E901G

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
PTB 138 271 2.99e-30 SMART
Pfam:DUF3694 301 432 1.6e-35 PFAM
low complexity region 449 460 N/A INTRINSIC
low complexity region 473 481 N/A INTRINSIC
low complexity region 502 516 N/A INTRINSIC
TBC 558 770 9.27e-74 SMART
Blast:TBC 803 880 9e-33 BLAST
coiled coil region 986 1038 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183690
SMART Domains Protein: ENSMUSP00000139145
Gene: ENSMUSG00000026915

DomainStartEndE-ValueType
DZF 81 334 2.45e-168 SMART
DSRM 388 452 3.11e-16 SMART
low complexity region 474 497 N/A INTRINSIC
DSRM 511 575 1.2e-22 SMART
low complexity region 578 593 N/A INTRINSIC
low complexity region 608 618 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik C T 7: 27,578,773 Q156* probably null Het
2700097O09Rik A G 12: 55,045,942 I264T probably benign Het
Arid3a G T 10: 79,950,884 M488I possibly damaging Het
Auts2 A G 5: 131,466,123 F331S probably damaging Het
Bpifb5 C A 2: 154,224,956 S43* probably null Het
Carhsp1 A G 16: 8,661,005 V128A probably benign Het
Ccdc141 A G 2: 77,132,297 V101A probably damaging Het
Cdk6 C G 5: 3,473,152 L191V probably damaging Het
Cgnl1 T G 9: 71,725,134 K312Q possibly damaging Het
Col6a1 T C 10: 76,721,443 E225G probably damaging Het
Copg1 T A 6: 87,902,340 L456Q probably damaging Het
Ctif T A 18: 75,437,208 D540V possibly damaging Het
Cyfip1 T C 7: 55,919,493 I917T probably benign Het
Cyth1 T C 11: 118,212,651 D9G probably benign Het
Dnajb1 T C 8: 83,610,255 I118T probably damaging Het
Ebna1bp2 T A 4: 118,623,378 Y139* probably null Het
Fam162a A T 16: 36,049,932 V59E probably damaging Het
Fam213a T C 14: 41,002,494 E71G probably benign Het
Fhad1 CGG CG 4: 141,918,291 probably null Het
Gm11639 A G 11: 104,693,422 T100A probably benign Het
Gm17087 T A 17: 8,566,472 D133V probably benign Het
Gm17689 C A 9: 36,582,558 W26C unknown Het
Gm21994 A T 2: 150,255,262 C82* probably null Het
Gm42669 A G 5: 107,508,276 I802V probably benign Het
Gp2 T C 7: 119,451,645 N288D probably damaging Het
Gstm7 C T 3: 107,926,962 D196N probably benign Het
Hsph1 A T 5: 149,630,400 V201D probably damaging Het
Il20ra T C 10: 19,712,710 L26P unknown Het
Itpr1 T A 6: 108,431,498 probably null Het
Kcns3 A T 12: 11,091,687 I337N probably damaging Het
Kdm4d A G 9: 14,464,179 Y128H probably damaging Het
Kirrel2 A G 7: 30,454,574 I200T probably benign Het
Klhdc10 T A 6: 30,450,503 I294N probably damaging Het
Map1a A C 2: 121,300,239 N512T probably damaging Het
March8 C G 6: 116,403,543 C118W probably damaging Het
March8 T G 6: 116,403,544 C119G probably damaging Het
Mrpl38 G T 11: 116,134,915 P195Q probably damaging Het
Ms4a4d A T 19: 11,548,583 Q27L probably benign Het
Muc16 T A 9: 18,658,236 T996S unknown Het
Mug1 C T 6: 121,861,125 A438V probably benign Het
Mup7 T A 4: 60,069,866 I33F probably damaging Het
Ndufa5 C T 6: 24,519,191 probably null Het
Olfr1133 A T 2: 87,645,976 L49Q probably damaging Het
Olfr1141 T C 2: 87,753,871 I41V probably benign Het
Olfr1535 A G 13: 21,555,938 F28S probably benign Het
Olfr167 A T 16: 19,515,456 F60Y probably benign Het
Olfr873 T A 9: 20,300,663 C154* probably null Het
Parp9 T A 16: 35,960,063 probably null Het
Pbx1 T A 1: 168,431,380 D42V probably damaging Het
Pde4dip G T 3: 97,715,422 N1490K possibly damaging Het
Pdzd2 T C 15: 12,372,561 N2496S probably benign Het
Pdzd2 A G 15: 12,372,975 M2358T probably benign Het
Pglyrp2 C A 17: 32,415,930 C486F probably damaging Het
Pi4ka A G 16: 17,297,067 probably benign Het
Pknox2 T A 9: 36,909,667 T300S probably damaging Het
Plekhm3 A G 1: 64,883,270 I582T probably damaging Het
Prtg T C 9: 72,891,985 Y766H possibly damaging Het
Rabgap1l A T 1: 160,342,072 N60K probably damaging Het
Rnf150 C T 8: 83,042,663 T359I probably benign Het
Rps6ka2 C T 17: 7,255,932 H236Y probably benign Het
Rrp1b T A 17: 32,049,427 L120Q probably damaging Het
Scn7a C A 2: 66,741,959 G223C probably null Het
Sema6a T A 18: 47,298,217 N138I probably damaging Het
Sept5 T A 16: 18,624,909 I97F probably damaging Het
Shcbp1 T A 8: 4,754,234 E225D probably damaging Het
Slc25a19 A G 11: 115,620,966 C124R probably damaging Het
Slc37a2 C T 9: 37,233,887 A428T probably damaging Het
Slc5a12 A G 2: 110,644,364 I538V probably benign Het
Smarcad1 T C 6: 65,052,670 S81P probably damaging Het
Smyd1 T C 6: 71,238,627 D116G probably damaging Het
Themis T C 10: 28,789,707 Y589H probably benign Het
Trim30d T C 7: 104,483,336 K248R probably benign Het
Tspan12 C T 6: 21,772,919 M210I probably benign Het
Vmn2r11 T C 5: 109,053,423 Y405C probably damaging Het
Wdfy3 A G 5: 101,894,909 probably null Het
Wiz C A 17: 32,361,866 A83S probably damaging Het
Zmym6 T A 4: 127,123,544 Y947* probably null Het
Other mutations in Rabgap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Rabgap1 APN 2 37469546 missense probably damaging 1.00
IGL01456:Rabgap1 APN 2 37541175 missense probably damaging 0.99
IGL01599:Rabgap1 APN 2 37556269 missense probably damaging 1.00
IGL01834:Rabgap1 APN 2 37564761 intron probably benign
IGL01940:Rabgap1 APN 2 37487067 missense probably damaging 1.00
IGL02416:Rabgap1 APN 2 37561950 missense probably benign 0.00
IGL02683:Rabgap1 APN 2 37502939 missense probably damaging 1.00
IGL02755:Rabgap1 APN 2 37537314 missense probably damaging 0.98
IGL02999:Rabgap1 APN 2 37483826 missense possibly damaging 0.56
IGL03144:Rabgap1 APN 2 37540532 missense probably damaging 0.99
IGL02796:Rabgap1 UTSW 2 37472306 missense probably damaging 0.99
R0117:Rabgap1 UTSW 2 37561885 splice site probably null
R0455:Rabgap1 UTSW 2 37487120 missense probably damaging 1.00
R0569:Rabgap1 UTSW 2 37489717 intron probably benign
R0586:Rabgap1 UTSW 2 37543223 missense probably benign
R0962:Rabgap1 UTSW 2 37560469 intron probably benign
R1055:Rabgap1 UTSW 2 37492068 missense possibly damaging 0.91
R1086:Rabgap1 UTSW 2 37469446 missense probably damaging 0.99
R1251:Rabgap1 UTSW 2 37543234 splice site probably null
R1598:Rabgap1 UTSW 2 37561899 missense probably damaging 1.00
R1924:Rabgap1 UTSW 2 37495759 critical splice donor site probably null
R1957:Rabgap1 UTSW 2 37483762 missense possibly damaging 0.93
R2134:Rabgap1 UTSW 2 37563487 nonsense probably null
R2154:Rabgap1 UTSW 2 37475441 missense probably damaging 1.00
R4328:Rabgap1 UTSW 2 37532615 missense probably damaging 1.00
R4351:Rabgap1 UTSW 2 37483782 missense probably benign
R4658:Rabgap1 UTSW 2 37487549 nonsense probably null
R4821:Rabgap1 UTSW 2 37532519 missense probably damaging 1.00
R4897:Rabgap1 UTSW 2 37560571 missense probably benign 0.01
R5014:Rabgap1 UTSW 2 37487140 missense probably damaging 1.00
R5252:Rabgap1 UTSW 2 37475357 missense probably benign 0.11
R5392:Rabgap1 UTSW 2 37469489 missense probably damaging 1.00
R5794:Rabgap1 UTSW 2 37502902 missense probably benign 0.03
R5941:Rabgap1 UTSW 2 37561896 missense possibly damaging 0.62
R6002:Rabgap1 UTSW 2 37473602 missense probably benign 0.05
R6209:Rabgap1 UTSW 2 37563598 nonsense probably null
R6317:Rabgap1 UTSW 2 37542647 missense possibly damaging 0.88
R7011:Rabgap1 UTSW 2 37540480 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCATCTGGATCAGCTCACTC -3'
(R):5'- TGGTCCCACCTCAAATGATG -3'

Sequencing Primer
(F):5'- TCACTCTACCTTCTCACAATAGGAG -3'
(R):5'- CCTCAAATGATGTACTAACTCATGC -3'
Posted On2019-05-13