Incidental Mutation 'R7014:Zmym6'
ID545168
Institutional Source Beutler Lab
Gene Symbol Zmym6
Ensembl Gene ENSMUSG00000042408
Gene Namezinc finger, MYM-type 6
SynonymsZfp258, D4Wsu24e, 9330177P20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7014 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location127077383-127124372 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 127123544 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 947 (Y947*)
Ref Sequence ENSEMBL: ENSMUSP00000092303 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046751] [ENSMUST00000094712] [ENSMUST00000094713] [ENSMUST00000106097]
Predicted Effect probably null
Transcript: ENSMUST00000046751
AA Change: Y1039*
SMART Domains Protein: ENSMUSP00000045366
Gene: ENSMUSG00000042408
AA Change: Y1039*

DomainStartEndE-ValueType
Blast:TRASH 77 113 1e-12 BLAST
TRASH 123 163 1.18e-1 SMART
TRASH 197 231 5.47e3 SMART
TRASH 241 277 4.01e1 SMART
TRASH 349 385 2.46e1 SMART
TRASH 391 426 3.32e2 SMART
TRASH 434 472 2.91e-1 SMART
TRASH 478 513 9.99e0 SMART
low complexity region 602 612 N/A INTRINSIC
low complexity region 642 656 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000094712
SMART Domains Protein: ENSMUSP00000092302
Gene: ENSMUSG00000070737

DomainStartEndE-ValueType
Pfam:DoxX 5 103 9e-9 PFAM
Pfam:DoxX_2 7 124 4.8e-15 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000094713
AA Change: Y947*
SMART Domains Protein: ENSMUSP00000092303
Gene: ENSMUSG00000042408
AA Change: Y947*

DomainStartEndE-ValueType
Blast:TRASH 77 113 1e-12 BLAST
TRASH 123 163 1.18e-1 SMART
TRASH 197 231 5.47e3 SMART
TRASH 262 293 6.03e2 SMART
TRASH 299 334 3.32e2 SMART
TRASH 342 380 2.91e-1 SMART
TRASH 386 421 9.99e0 SMART
low complexity region 510 520 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106097
SMART Domains Protein: ENSMUSP00000101703
Gene: ENSMUSG00000070737

DomainStartEndE-ValueType
Pfam:DoxX_2 27 111 8.1e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 99% (80/81)
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik C T 7: 27,578,773 Q156* probably null Het
2700097O09Rik A G 12: 55,045,942 I264T probably benign Het
Arid3a G T 10: 79,950,884 M488I possibly damaging Het
Auts2 A G 5: 131,466,123 F331S probably damaging Het
Axdnd1 T C 1: 156,330,962 probably null Het
Bpifb5 C A 2: 154,224,956 S43* probably null Het
Carhsp1 A G 16: 8,661,005 V128A probably benign Het
Ccdc141 A G 2: 77,132,297 V101A probably damaging Het
Cdk6 C G 5: 3,473,152 L191V probably damaging Het
Cgnl1 T G 9: 71,725,134 K312Q possibly damaging Het
Col6a1 T C 10: 76,721,443 E225G probably damaging Het
Copg1 T A 6: 87,902,340 L456Q probably damaging Het
Ctif T A 18: 75,437,208 D540V possibly damaging Het
Cyfip1 T C 7: 55,919,493 I917T probably benign Het
Cyth1 T C 11: 118,212,651 D9G probably benign Het
Dnajb1 T C 8: 83,610,255 I118T probably damaging Het
Ebna1bp2 T A 4: 118,623,378 Y139* probably null Het
Fam162a A T 16: 36,049,932 V59E probably damaging Het
Fam213a T C 14: 41,002,494 E71G probably benign Het
Fhad1 CGG CG 4: 141,918,291 probably null Het
Fmo6 C G 1: 162,926,308 R112T probably benign Het
Gm11639 A G 11: 104,693,422 T100A probably benign Het
Gm17087 T A 17: 8,566,472 D133V probably benign Het
Gm17689 C A 9: 36,582,558 W26C unknown Het
Gm21994 A T 2: 150,255,262 C82* probably null Het
Gm42669 A G 5: 107,508,276 I802V probably benign Het
Gp2 T C 7: 119,451,645 N288D probably damaging Het
Gstm7 C T 3: 107,926,962 D196N probably benign Het
Hsph1 A T 5: 149,630,400 V201D probably damaging Het
Il20ra T C 10: 19,712,710 L26P unknown Het
Itpr1 T A 6: 108,431,498 probably null Het
Kcns3 A T 12: 11,091,687 I337N probably damaging Het
Kdm4d A G 9: 14,464,179 Y128H probably damaging Het
Kirrel2 A G 7: 30,454,574 I200T probably benign Het
Klhdc10 T A 6: 30,450,503 I294N probably damaging Het
Map1a A C 2: 121,300,239 N512T probably damaging Het
March8 C G 6: 116,403,543 C118W probably damaging Het
March8 T G 6: 116,403,544 C119G probably damaging Het
Mrpl38 G T 11: 116,134,915 P195Q probably damaging Het
Ms4a4d A T 19: 11,548,583 Q27L probably benign Het
Muc16 T A 9: 18,658,236 T996S unknown Het
Mug1 C T 6: 121,861,125 A438V probably benign Het
Mup7 T A 4: 60,069,866 I33F probably damaging Het
Ndufa5 C T 6: 24,519,191 probably null Het
Olfr1133 A T 2: 87,645,976 L49Q probably damaging Het
Olfr1141 T C 2: 87,753,871 I41V probably benign Het
Olfr1535 A G 13: 21,555,938 F28S probably benign Het
Olfr167 A T 16: 19,515,456 F60Y probably benign Het
Olfr873 T A 9: 20,300,663 C154* probably null Het
Parp9 T A 16: 35,960,063 probably null Het
Pbx1 T A 1: 168,431,380 D42V probably damaging Het
Pde4dip G T 3: 97,715,422 N1490K possibly damaging Het
Pdzd2 T C 15: 12,372,561 N2496S probably benign Het
Pdzd2 A G 15: 12,372,975 M2358T probably benign Het
Pglyrp2 C A 17: 32,415,930 C486F probably damaging Het
Pi4ka A G 16: 17,297,067 probably benign Het
Pknox2 T A 9: 36,909,667 T300S probably damaging Het
Plekhm3 A G 1: 64,883,270 I582T probably damaging Het
Prtg T C 9: 72,891,985 Y766H possibly damaging Het
Rabgap1 A G 2: 37,560,563 E901G probably benign Het
Rabgap1l A T 1: 160,342,072 N60K probably damaging Het
Rnf150 C T 8: 83,042,663 T359I probably benign Het
Rps6ka2 C T 17: 7,255,932 H236Y probably benign Het
Rrp1b T A 17: 32,049,427 L120Q probably damaging Het
Scn7a C A 2: 66,741,959 G223C probably null Het
Sema6a T A 18: 47,298,217 N138I probably damaging Het
Sept5 T A 16: 18,624,909 I97F probably damaging Het
Shcbp1 T A 8: 4,754,234 E225D probably damaging Het
Slc25a19 A G 11: 115,620,966 C124R probably damaging Het
Slc37a2 C T 9: 37,233,887 A428T probably damaging Het
Slc5a12 A G 2: 110,644,364 I538V probably benign Het
Slco4c1 A T 1: 96,823,781 probably null Het
Smarcad1 T C 6: 65,052,670 S81P probably damaging Het
Smyd1 T C 6: 71,238,627 D116G probably damaging Het
Themis T C 10: 28,789,707 Y589H probably benign Het
Trim30d T C 7: 104,483,336 K248R probably benign Het
Tspan12 C T 6: 21,772,919 M210I probably benign Het
Vmn2r11 T C 5: 109,053,423 Y405C probably damaging Het
Wdfy3 A G 5: 101,894,909 probably null Het
Wiz C A 17: 32,361,866 A83S probably damaging Het
Other mutations in Zmym6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Zmym6 APN 4 127101949 nonsense probably null
IGL00486:Zmym6 APN 4 127124185 utr 5 prime probably benign
IGL01017:Zmym6 APN 4 127088359 missense probably benign 0.00
IGL01385:Zmym6 APN 4 127124106 missense probably benign 0.02
IGL01577:Zmym6 APN 4 127105430 missense probably damaging 1.00
IGL01654:Zmym6 APN 4 127123726 missense probably damaging 1.00
IGL01736:Zmym6 APN 4 127108644 missense probably damaging 1.00
IGL01824:Zmym6 APN 4 127108706 missense probably damaging 0.99
IGL01916:Zmym6 APN 4 127123756 missense probably damaging 0.98
IGL01985:Zmym6 APN 4 127100748 missense probably damaging 1.00
IGL02056:Zmym6 APN 4 127103414 missense probably damaging 1.00
IGL02477:Zmym6 APN 4 127078502 nonsense probably null
IGL02754:Zmym6 APN 4 127109971 splice site probably benign
IGL03344:Zmym6 APN 4 127120521 missense probably damaging 1.00
IGL03412:Zmym6 APN 4 127092938 missense probably damaging 1.00
R0335:Zmym6 UTSW 4 127122808 missense probably damaging 1.00
R0448:Zmym6 UTSW 4 127108694 missense probably benign 0.01
R0463:Zmym6 UTSW 4 127122772 missense probably damaging 0.98
R0538:Zmym6 UTSW 4 127123369 missense probably benign 0.21
R0789:Zmym6 UTSW 4 127122822 missense possibly damaging 0.52
R0798:Zmym6 UTSW 4 127103523 missense probably benign 0.00
R1311:Zmym6 UTSW 4 127123358 missense probably damaging 1.00
R1351:Zmym6 UTSW 4 127123005 missense probably benign 0.00
R1429:Zmym6 UTSW 4 127123879 missense probably damaging 1.00
R1636:Zmym6 UTSW 4 127123767 missense probably damaging 0.99
R1666:Zmym6 UTSW 4 127122859 missense probably damaging 0.98
R1919:Zmym6 UTSW 4 127103414 missense probably damaging 1.00
R2058:Zmym6 UTSW 4 127088415 nonsense probably null
R3957:Zmym6 UTSW 4 127123296 missense possibly damaging 0.68
R3978:Zmym6 UTSW 4 127123555 missense possibly damaging 0.71
R4417:Zmym6 UTSW 4 127092988 missense probably damaging 1.00
R4801:Zmym6 UTSW 4 127123216 missense probably benign 0.19
R4802:Zmym6 UTSW 4 127123216 missense probably benign 0.19
R5052:Zmym6 UTSW 4 127123974 missense possibly damaging 0.92
R5105:Zmym6 UTSW 4 127123758 missense probably benign 0.33
R5217:Zmym6 UTSW 4 127105374 missense possibly damaging 0.76
R5682:Zmym6 UTSW 4 127104407 missense probably damaging 1.00
R5841:Zmym6 UTSW 4 127100670 missense possibly damaging 0.71
R5991:Zmym6 UTSW 4 127108473 intron probably null
R6478:Zmym6 UTSW 4 127123383 missense possibly damaging 0.86
R7287:Zmym6 UTSW 4 127122982 missense possibly damaging 0.50
R7290:Zmym6 UTSW 4 127123501 missense possibly damaging 0.73
R7371:Zmym6 UTSW 4 127104313 missense probably damaging 1.00
X0025:Zmym6 UTSW 4 127122350 missense possibly damaging 0.60
X0067:Zmym6 UTSW 4 127104314 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGATCTGAGCATGTGAATTTACC -3'
(R):5'- TGGGTAACAGGCATGGAATATC -3'

Sequencing Primer
(F):5'- CCACTTAATGCTGAAGTACGCTGG -3'
(R):5'- ATCTGAGAAAGTCCTTCCAGGTGC -3'
Posted On2019-05-13