Incidental Mutation 'R7014:Hsph1'
ID545175
Institutional Source Beutler Lab
Gene Symbol Hsph1
Ensembl Gene ENSMUSG00000029657
Gene Nameheat shock 105kDa/110kDa protein 1
SynonymsHsp105, hsp-E7I, HSP110
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.498) question?
Stock #R7014 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location149614287-149636376 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 149630400 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 201 (V201D)
Ref Sequence ENSEMBL: ENSMUSP00000144413 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074846] [ENSMUST00000200805] [ENSMUST00000200825] [ENSMUST00000201452] [ENSMUST00000201559] [ENSMUST00000202089] [ENSMUST00000202361]
Predicted Effect probably damaging
Transcript: ENSMUST00000074846
AA Change: V201D

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000074392
Gene: ENSMUSG00000029657
AA Change: V201D

DomainStartEndE-ValueType
Pfam:HSP70 3 709 7.3e-190 PFAM
low complexity region 756 768 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200805
SMART Domains Protein: ENSMUSP00000143925
Gene: ENSMUSG00000029657

DomainStartEndE-ValueType
Pfam:HSP70 1 94 5.2e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000200825
SMART Domains Protein: ENSMUSP00000143913
Gene: ENSMUSG00000029657

DomainStartEndE-ValueType
Pfam:HSP70 3 100 1.4e-34 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000201452
AA Change: V201D

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000144654
Gene: ENSMUSG00000029657
AA Change: V201D

DomainStartEndE-ValueType
Pfam:HSP70 3 709 7.3e-190 PFAM
low complexity region 756 768 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000201559
AA Change: V108D

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000144043
Gene: ENSMUSG00000029657
AA Change: V108D

DomainStartEndE-ValueType
Pfam:HSP70 1 144 2.1e-58 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000202089
AA Change: V160D

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000144297
Gene: ENSMUSG00000029657
AA Change: V160D

DomainStartEndE-ValueType
Pfam:HSP70 3 103 1.3e-33 PFAM
Pfam:HSP70 98 668 8.5e-135 PFAM
low complexity region 715 727 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000202361
AA Change: V201D

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000144413
Gene: ENSMUSG00000029657
AA Change: V201D

DomainStartEndE-ValueType
Pfam:HSP70 3 709 7.3e-190 PFAM
low complexity region 756 768 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 99% (80/81)
MGI Phenotype PHENOTYPE: Homozygous inactivation of this gene leads to decreased susceptibility to ischemic brain injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik C T 7: 27,578,773 Q156* probably null Het
2700097O09Rik A G 12: 55,045,942 I264T probably benign Het
Arid3a G T 10: 79,950,884 M488I possibly damaging Het
Auts2 A G 5: 131,466,123 F331S probably damaging Het
Axdnd1 T C 1: 156,330,962 probably null Het
Bpifb5 C A 2: 154,224,956 S43* probably null Het
Carhsp1 A G 16: 8,661,005 V128A probably benign Het
Ccdc141 A G 2: 77,132,297 V101A probably damaging Het
Cdk6 C G 5: 3,473,152 L191V probably damaging Het
Cgnl1 T G 9: 71,725,134 K312Q possibly damaging Het
Col6a1 T C 10: 76,721,443 E225G probably damaging Het
Copg1 T A 6: 87,902,340 L456Q probably damaging Het
Ctif T A 18: 75,437,208 D540V possibly damaging Het
Cyfip1 T C 7: 55,919,493 I917T probably benign Het
Cyth1 T C 11: 118,212,651 D9G probably benign Het
Dnajb1 T C 8: 83,610,255 I118T probably damaging Het
Ebna1bp2 T A 4: 118,623,378 Y139* probably null Het
Fam162a A T 16: 36,049,932 V59E probably damaging Het
Fam213a T C 14: 41,002,494 E71G probably benign Het
Fhad1 CGG CG 4: 141,918,291 probably null Het
Fmo6 C G 1: 162,926,308 R112T probably benign Het
Gm11639 A G 11: 104,693,422 T100A probably benign Het
Gm17087 T A 17: 8,566,472 D133V probably benign Het
Gm17689 C A 9: 36,582,558 W26C unknown Het
Gm21994 A T 2: 150,255,262 C82* probably null Het
Gm42669 A G 5: 107,508,276 I802V probably benign Het
Gp2 T C 7: 119,451,645 N288D probably damaging Het
Gstm7 C T 3: 107,926,962 D196N probably benign Het
Il20ra T C 10: 19,712,710 L26P unknown Het
Itpr1 T A 6: 108,431,498 probably null Het
Kcns3 A T 12: 11,091,687 I337N probably damaging Het
Kdm4d A G 9: 14,464,179 Y128H probably damaging Het
Kirrel2 A G 7: 30,454,574 I200T probably benign Het
Klhdc10 T A 6: 30,450,503 I294N probably damaging Het
Map1a A C 2: 121,300,239 N512T probably damaging Het
March8 C G 6: 116,403,543 C118W probably damaging Het
March8 T G 6: 116,403,544 C119G probably damaging Het
Mrpl38 G T 11: 116,134,915 P195Q probably damaging Het
Ms4a4d A T 19: 11,548,583 Q27L probably benign Het
Muc16 T A 9: 18,658,236 T996S unknown Het
Mug1 C T 6: 121,861,125 A438V probably benign Het
Mup7 T A 4: 60,069,866 I33F probably damaging Het
Ndufa5 C T 6: 24,519,191 probably null Het
Olfr1133 A T 2: 87,645,976 L49Q probably damaging Het
Olfr1141 T C 2: 87,753,871 I41V probably benign Het
Olfr1535 A G 13: 21,555,938 F28S probably benign Het
Olfr167 A T 16: 19,515,456 F60Y probably benign Het
Olfr873 T A 9: 20,300,663 C154* probably null Het
Parp9 T A 16: 35,960,063 probably null Het
Pbx1 T A 1: 168,431,380 D42V probably damaging Het
Pde4dip G T 3: 97,715,422 N1490K possibly damaging Het
Pdzd2 T C 15: 12,372,561 N2496S probably benign Het
Pdzd2 A G 15: 12,372,975 M2358T probably benign Het
Pglyrp2 C A 17: 32,415,930 C486F probably damaging Het
Pi4ka A G 16: 17,297,067 probably benign Het
Pknox2 T A 9: 36,909,667 T300S probably damaging Het
Plekhm3 A G 1: 64,883,270 I582T probably damaging Het
Prtg T C 9: 72,891,985 Y766H possibly damaging Het
Rabgap1 A G 2: 37,560,563 E901G probably benign Het
Rabgap1l A T 1: 160,342,072 N60K probably damaging Het
Rnf150 C T 8: 83,042,663 T359I probably benign Het
Rps6ka2 C T 17: 7,255,932 H236Y probably benign Het
Rrp1b T A 17: 32,049,427 L120Q probably damaging Het
Scn7a C A 2: 66,741,959 G223C probably null Het
Sema6a T A 18: 47,298,217 N138I probably damaging Het
Sept5 T A 16: 18,624,909 I97F probably damaging Het
Shcbp1 T A 8: 4,754,234 E225D probably damaging Het
Slc25a19 A G 11: 115,620,966 C124R probably damaging Het
Slc37a2 C T 9: 37,233,887 A428T probably damaging Het
Slc5a12 A G 2: 110,644,364 I538V probably benign Het
Slco4c1 A T 1: 96,823,781 probably null Het
Smarcad1 T C 6: 65,052,670 S81P probably damaging Het
Smyd1 T C 6: 71,238,627 D116G probably damaging Het
Themis T C 10: 28,789,707 Y589H probably benign Het
Trim30d T C 7: 104,483,336 K248R probably benign Het
Tspan12 C T 6: 21,772,919 M210I probably benign Het
Vmn2r11 T C 5: 109,053,423 Y405C probably damaging Het
Wdfy3 A G 5: 101,894,909 probably null Het
Wiz C A 17: 32,361,866 A83S probably damaging Het
Zmym6 T A 4: 127,123,544 Y947* probably null Het
Other mutations in Hsph1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Hsph1 APN 5 149618789 missense possibly damaging 0.95
IGL00839:Hsph1 APN 5 149618454 missense possibly damaging 0.47
IGL00965:Hsph1 APN 5 149630804 missense probably damaging 1.00
IGL01529:Hsph1 APN 5 149636034 missense probably benign 0.01
IGL01613:Hsph1 APN 5 149627278 missense probably benign 0.34
IGL02023:Hsph1 APN 5 149633859 missense probably damaging 1.00
IGL02272:Hsph1 APN 5 149617530 missense probably benign 0.00
IGL02754:Hsph1 APN 5 149623592 missense possibly damaging 0.95
R0666:Hsph1 UTSW 5 149631502 missense probably damaging 1.00
R1061:Hsph1 UTSW 5 149618418 missense possibly damaging 0.93
R1163:Hsph1 UTSW 5 149630801 missense probably damaging 1.00
R1511:Hsph1 UTSW 5 149630383 missense probably benign 0.03
R1794:Hsph1 UTSW 5 149630773 missense probably damaging 1.00
R1806:Hsph1 UTSW 5 149629989 missense probably damaging 0.99
R1847:Hsph1 UTSW 5 149623485 nonsense probably null
R2143:Hsph1 UTSW 5 149631486 missense probably damaging 0.99
R2144:Hsph1 UTSW 5 149630337 critical splice donor site probably null
R2917:Hsph1 UTSW 5 149630786 nonsense probably null
R3840:Hsph1 UTSW 5 149620715 intron probably null
R3841:Hsph1 UTSW 5 149620715 intron probably null
R4378:Hsph1 UTSW 5 149636007 nonsense probably null
R4577:Hsph1 UTSW 5 149618843 missense probably benign 0.03
R4618:Hsph1 UTSW 5 149618843 missense probably benign 0.03
R4621:Hsph1 UTSW 5 149618843 missense probably benign 0.03
R5898:Hsph1 UTSW 5 149625158 missense probably damaging 1.00
R6114:Hsph1 UTSW 5 149627387 missense possibly damaging 0.53
R6185:Hsph1 UTSW 5 149617695 missense probably damaging 1.00
R6432:Hsph1 UTSW 5 149618976 missense probably damaging 0.99
R6678:Hsph1 UTSW 5 149618497 missense probably benign 0.00
R7189:Hsph1 UTSW 5 149630460 missense probably damaging 1.00
R7438:Hsph1 UTSW 5 149619020 missense probably damaging 1.00
R7502:Hsph1 UTSW 5 149630373 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATGTTTACTGTCTACACTGATGCG -3'
(R):5'- ACTTGCTGGTAATTATGGAGCG -3'

Sequencing Primer
(F):5'- TGTCTACACTGATGCGAACCTTAAAC -3'
(R):5'- TTATGGAGCGATGGAAAGTTATCC -3'
Posted On2019-05-13