Incidental Mutation 'R7014:March8'
ID545183
Institutional Source Beutler Lab
Gene Symbol March8
Ensembl Gene ENSMUSG00000025702
Gene Namemembrane-associated ring finger (C3HC4) 8
Synonyms1300017E09Rik, Mir
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.197) question?
Stock #R7014 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location116338024-116409540 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 116403543 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tryptophan at position 118 (C118W)
Ref Sequence ENSEMBL: ENSMUSP00000145351 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079012] [ENSMUST00000101032] [ENSMUST00000123405] [ENSMUST00000135901] [ENSMUST00000140884] [ENSMUST00000203116] [ENSMUST00000203193] [ENSMUST00000204657]
Predicted Effect probably damaging
Transcript: ENSMUST00000079012
AA Change: C118W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000078024
Gene: ENSMUSG00000025702
AA Change: C118W

DomainStartEndE-ValueType
low complexity region 47 64 N/A INTRINSIC
RINGv 75 123 1.16e-23 SMART
transmembrane domain 151 173 N/A INTRINSIC
transmembrane domain 188 210 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000101032
AA Change: C118W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000098594
Gene: ENSMUSG00000025702
AA Change: C118W

DomainStartEndE-ValueType
low complexity region 47 64 N/A INTRINSIC
RINGv 75 123 1.16e-23 SMART
transmembrane domain 151 173 N/A INTRINSIC
transmembrane domain 188 210 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000123405
AA Change: C400W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000144936
Gene: ENSMUSG00000025702
AA Change: C400W

DomainStartEndE-ValueType
low complexity region 47 64 N/A INTRINSIC
low complexity region 258 270 N/A INTRINSIC
RINGv 357 405 2.4e-25 SMART
transmembrane domain 433 455 N/A INTRINSIC
transmembrane domain 475 497 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000135901
AA Change: C97W

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000115510
Gene: ENSMUSG00000025702
AA Change: C97W

DomainStartEndE-ValueType
low complexity region 43 60 N/A INTRINSIC
RINGv 71 119 1.16e-23 SMART
transmembrane domain 147 169 N/A INTRINSIC
transmembrane domain 184 206 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140884
SMART Domains Protein: ENSMUSP00000145060
Gene: ENSMUSG00000025702

DomainStartEndE-ValueType
low complexity region 47 64 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203116
Predicted Effect probably damaging
Transcript: ENSMUST00000203193
AA Change: C79W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000145137
Gene: ENSMUSG00000025702
AA Change: C79W

DomainStartEndE-ValueType
low complexity region 8 25 N/A INTRINSIC
RINGv 36 84 2.9e-26 SMART
transmembrane domain 112 134 N/A INTRINSIC
transmembrane domain 149 171 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000204657
AA Change: C118W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000145351
Gene: ENSMUSG00000025702
AA Change: C118W

DomainStartEndE-ValueType
low complexity region 47 64 N/A INTRINSIC
RINGv 75 123 2.9e-26 SMART
transmembrane domain 151 173 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the membrane-associated really interesting new gene-CH family of proteins. These proteins are E3 ubiquitin-protein ligases that modulate antigen presentation by downregulating major histocompatibility complex class II surface expression through endocytosis. The transcript is primarily expressed by dendritic cells and macrophages. Overexpression of this gene in antigen presenting cells results in immune defective phenotypes, including resistance to autoimmune disease onset. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a normal CD4+ T cell compartment in the thymus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik C T 7: 27,578,773 Q156* probably null Het
2700097O09Rik A G 12: 55,045,942 I264T probably benign Het
Arid3a G T 10: 79,950,884 M488I possibly damaging Het
Auts2 A G 5: 131,466,123 F331S probably damaging Het
Axdnd1 T C 1: 156,330,962 probably null Het
Bpifb5 C A 2: 154,224,956 S43* probably null Het
Carhsp1 A G 16: 8,661,005 V128A probably benign Het
Ccdc141 A G 2: 77,132,297 V101A probably damaging Het
Cdk6 C G 5: 3,473,152 L191V probably damaging Het
Cgnl1 T G 9: 71,725,134 K312Q possibly damaging Het
Col6a1 T C 10: 76,721,443 E225G probably damaging Het
Copg1 T A 6: 87,902,340 L456Q probably damaging Het
Ctif T A 18: 75,437,208 D540V possibly damaging Het
Cyfip1 T C 7: 55,919,493 I917T probably benign Het
Cyth1 T C 11: 118,212,651 D9G probably benign Het
Dnajb1 T C 8: 83,610,255 I118T probably damaging Het
Ebna1bp2 T A 4: 118,623,378 Y139* probably null Het
Fam162a A T 16: 36,049,932 V59E probably damaging Het
Fam213a T C 14: 41,002,494 E71G probably benign Het
Fhad1 CGG CG 4: 141,918,291 probably null Het
Fmo6 C G 1: 162,926,308 R112T probably benign Het
Gm11639 A G 11: 104,693,422 T100A probably benign Het
Gm17087 T A 17: 8,566,472 D133V probably benign Het
Gm17689 C A 9: 36,582,558 W26C unknown Het
Gm21994 A T 2: 150,255,262 C82* probably null Het
Gm42669 A G 5: 107,508,276 I802V probably benign Het
Gp2 T C 7: 119,451,645 N288D probably damaging Het
Gstm7 C T 3: 107,926,962 D196N probably benign Het
Hsph1 A T 5: 149,630,400 V201D probably damaging Het
Il20ra T C 10: 19,712,710 L26P unknown Het
Itpr1 T A 6: 108,431,498 probably null Het
Kcns3 A T 12: 11,091,687 I337N probably damaging Het
Kdm4d A G 9: 14,464,179 Y128H probably damaging Het
Kirrel2 A G 7: 30,454,574 I200T probably benign Het
Klhdc10 T A 6: 30,450,503 I294N probably damaging Het
Map1a A C 2: 121,300,239 N512T probably damaging Het
Mrpl38 G T 11: 116,134,915 P195Q probably damaging Het
Ms4a4d A T 19: 11,548,583 Q27L probably benign Het
Muc16 T A 9: 18,658,236 T996S unknown Het
Mug1 C T 6: 121,861,125 A438V probably benign Het
Mup7 T A 4: 60,069,866 I33F probably damaging Het
Ndufa5 C T 6: 24,519,191 probably null Het
Olfr1133 A T 2: 87,645,976 L49Q probably damaging Het
Olfr1141 T C 2: 87,753,871 I41V probably benign Het
Olfr1535 A G 13: 21,555,938 F28S probably benign Het
Olfr167 A T 16: 19,515,456 F60Y probably benign Het
Olfr873 T A 9: 20,300,663 C154* probably null Het
Parp9 T A 16: 35,960,063 probably null Het
Pbx1 T A 1: 168,431,380 D42V probably damaging Het
Pde4dip G T 3: 97,715,422 N1490K possibly damaging Het
Pdzd2 T C 15: 12,372,561 N2496S probably benign Het
Pdzd2 A G 15: 12,372,975 M2358T probably benign Het
Pglyrp2 C A 17: 32,415,930 C486F probably damaging Het
Pi4ka A G 16: 17,297,067 probably benign Het
Pknox2 T A 9: 36,909,667 T300S probably damaging Het
Plekhm3 A G 1: 64,883,270 I582T probably damaging Het
Prtg T C 9: 72,891,985 Y766H possibly damaging Het
Rabgap1 A G 2: 37,560,563 E901G probably benign Het
Rabgap1l A T 1: 160,342,072 N60K probably damaging Het
Rnf150 C T 8: 83,042,663 T359I probably benign Het
Rps6ka2 C T 17: 7,255,932 H236Y probably benign Het
Rrp1b T A 17: 32,049,427 L120Q probably damaging Het
Scn7a C A 2: 66,741,959 G223C probably null Het
Sema6a T A 18: 47,298,217 N138I probably damaging Het
Sept5 T A 16: 18,624,909 I97F probably damaging Het
Shcbp1 T A 8: 4,754,234 E225D probably damaging Het
Slc25a19 A G 11: 115,620,966 C124R probably damaging Het
Slc37a2 C T 9: 37,233,887 A428T probably damaging Het
Slc5a12 A G 2: 110,644,364 I538V probably benign Het
Slco4c1 A T 1: 96,823,781 probably null Het
Smarcad1 T C 6: 65,052,670 S81P probably damaging Het
Smyd1 T C 6: 71,238,627 D116G probably damaging Het
Themis T C 10: 28,789,707 Y589H probably benign Het
Trim30d T C 7: 104,483,336 K248R probably benign Het
Tspan12 C T 6: 21,772,919 M210I probably benign Het
Vmn2r11 T C 5: 109,053,423 Y405C probably damaging Het
Wdfy3 A G 5: 101,894,909 probably null Het
Wiz C A 17: 32,361,866 A83S probably damaging Het
Zmym6 T A 4: 127,123,544 Y947* probably null Het
Other mutations in March8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02966:March8 APN 6 116403538 missense probably damaging 1.00
strider UTSW 6 116402043 missense probably benign
R0828:March8 UTSW 6 116405678 missense probably benign 0.36
R2869:March8 UTSW 6 116401145 intron probably benign
R2870:March8 UTSW 6 116401145 intron probably benign
R4963:March8 UTSW 6 116386271 intron probably benign
R5617:March8 UTSW 6 116403520 missense possibly damaging 0.55
R6329:March8 UTSW 6 116406316 missense possibly damaging 0.78
R6361:March8 UTSW 6 116402101 missense probably null 1.00
R6615:March8 UTSW 6 116405663 missense probably damaging 1.00
R6771:March8 UTSW 6 116402043 missense probably benign
R7014:March8 UTSW 6 116403544 missense probably damaging 1.00
R7249:March8 UTSW 6 116406234 missense probably benign 0.17
R7558:March8 UTSW 6 116403565 missense not run
Predicted Primers PCR Primer
(F):5'- GTGCTGACAGTCACTTTTACGG -3'
(R):5'- CAGAAGTAAGGCTCGACAGC -3'

Sequencing Primer
(F):5'- AATTGGCCTTCTGGTGCAGC -3'
(R):5'- GCAAGCACTCCAGCCTCAATTTC -3'
Posted On2019-05-13