Incidental Mutation 'R7014:Rps6ka2'
ID545222
Institutional Source Beutler Lab
Gene Symbol Rps6ka2
Ensembl Gene ENSMUSG00000023809
Gene Nameribosomal protein S6 kinase, polypeptide 2
SynonymsRps6ka-rs1, pp90rsk, p90rsk, D17Wsu134e, 90kDa, Rsk3
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.597) question?
Stock #R7014 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location7170115-7303315 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 7255932 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 236 (H236Y)
Ref Sequence ENSEMBL: ENSMUSP00000024575 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024575] [ENSMUST00000232527]
Predicted Effect probably benign
Transcript: ENSMUST00000024575
AA Change: H236Y

PolyPhen 2 Score 0.290 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000024575
Gene: ENSMUSG00000023809
AA Change: H236Y

DomainStartEndE-ValueType
low complexity region 18 35 N/A INTRINSIC
S_TKc 59 318 6.25e-107 SMART
S_TK_X 319 380 3.36e-20 SMART
S_TKc 415 672 1.84e-104 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000232527
AA Change: H202Y

PolyPhen 2 Score 0.187 (Sensitivity: 0.92; Specificity: 0.87)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the RSK (ribosomal S6 kinase) family of serine/threonine kinases. This kinase contains two non-identical kinase catalytic domains and phosphorylates various substrates, including members of the mitogen-activated kinase (MAPK) signalling pathway. The activity of this protein has been implicated in controlling cell growth and differentiation. Alternative splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased response of heart to stress following transverse aortic constriction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik C T 7: 27,578,773 Q156* probably null Het
2700097O09Rik A G 12: 55,045,942 I264T probably benign Het
Arid3a G T 10: 79,950,884 M488I possibly damaging Het
Auts2 A G 5: 131,466,123 F331S probably damaging Het
Axdnd1 T C 1: 156,330,962 probably null Het
Bpifb5 C A 2: 154,224,956 S43* probably null Het
Carhsp1 A G 16: 8,661,005 V128A probably benign Het
Ccdc141 A G 2: 77,132,297 V101A probably damaging Het
Cdk6 C G 5: 3,473,152 L191V probably damaging Het
Cgnl1 T G 9: 71,725,134 K312Q possibly damaging Het
Col6a1 T C 10: 76,721,443 E225G probably damaging Het
Copg1 T A 6: 87,902,340 L456Q probably damaging Het
Ctif T A 18: 75,437,208 D540V possibly damaging Het
Cyfip1 T C 7: 55,919,493 I917T probably benign Het
Cyth1 T C 11: 118,212,651 D9G probably benign Het
Dnajb1 T C 8: 83,610,255 I118T probably damaging Het
Ebna1bp2 T A 4: 118,623,378 Y139* probably null Het
Fam162a A T 16: 36,049,932 V59E probably damaging Het
Fam213a T C 14: 41,002,494 E71G probably benign Het
Fhad1 CGG CG 4: 141,918,291 probably null Het
Fmo6 C G 1: 162,926,308 R112T probably benign Het
Gm11639 A G 11: 104,693,422 T100A probably benign Het
Gm17087 T A 17: 8,566,472 D133V probably benign Het
Gm17689 C A 9: 36,582,558 W26C unknown Het
Gm21994 A T 2: 150,255,262 C82* probably null Het
Gm42669 A G 5: 107,508,276 I802V probably benign Het
Gp2 T C 7: 119,451,645 N288D probably damaging Het
Gstm7 C T 3: 107,926,962 D196N probably benign Het
Hsph1 A T 5: 149,630,400 V201D probably damaging Het
Il20ra T C 10: 19,712,710 L26P unknown Het
Itpr1 T A 6: 108,431,498 probably null Het
Kcns3 A T 12: 11,091,687 I337N probably damaging Het
Kdm4d A G 9: 14,464,179 Y128H probably damaging Het
Kirrel2 A G 7: 30,454,574 I200T probably benign Het
Klhdc10 T A 6: 30,450,503 I294N probably damaging Het
Map1a A C 2: 121,300,239 N512T probably damaging Het
March8 C G 6: 116,403,543 C118W probably damaging Het
March8 T G 6: 116,403,544 C119G probably damaging Het
Mrpl38 G T 11: 116,134,915 P195Q probably damaging Het
Ms4a4d A T 19: 11,548,583 Q27L probably benign Het
Muc16 T A 9: 18,658,236 T996S unknown Het
Mug1 C T 6: 121,861,125 A438V probably benign Het
Mup7 T A 4: 60,069,866 I33F probably damaging Het
Ndufa5 C T 6: 24,519,191 probably null Het
Olfr1133 A T 2: 87,645,976 L49Q probably damaging Het
Olfr1141 T C 2: 87,753,871 I41V probably benign Het
Olfr1535 A G 13: 21,555,938 F28S probably benign Het
Olfr167 A T 16: 19,515,456 F60Y probably benign Het
Olfr873 T A 9: 20,300,663 C154* probably null Het
Parp9 T A 16: 35,960,063 probably null Het
Pbx1 T A 1: 168,431,380 D42V probably damaging Het
Pde4dip G T 3: 97,715,422 N1490K possibly damaging Het
Pdzd2 T C 15: 12,372,561 N2496S probably benign Het
Pdzd2 A G 15: 12,372,975 M2358T probably benign Het
Pglyrp2 C A 17: 32,415,930 C486F probably damaging Het
Pi4ka A G 16: 17,297,067 probably benign Het
Pknox2 T A 9: 36,909,667 T300S probably damaging Het
Plekhm3 A G 1: 64,883,270 I582T probably damaging Het
Prtg T C 9: 72,891,985 Y766H possibly damaging Het
Rabgap1 A G 2: 37,560,563 E901G probably benign Het
Rabgap1l A T 1: 160,342,072 N60K probably damaging Het
Rnf150 C T 8: 83,042,663 T359I probably benign Het
Rrp1b T A 17: 32,049,427 L120Q probably damaging Het
Scn7a C A 2: 66,741,959 G223C probably null Het
Sema6a T A 18: 47,298,217 N138I probably damaging Het
Sept5 T A 16: 18,624,909 I97F probably damaging Het
Shcbp1 T A 8: 4,754,234 E225D probably damaging Het
Slc25a19 A G 11: 115,620,966 C124R probably damaging Het
Slc37a2 C T 9: 37,233,887 A428T probably damaging Het
Slc5a12 A G 2: 110,644,364 I538V probably benign Het
Slco4c1 A T 1: 96,823,781 probably null Het
Smarcad1 T C 6: 65,052,670 S81P probably damaging Het
Smyd1 T C 6: 71,238,627 D116G probably damaging Het
Themis T C 10: 28,789,707 Y589H probably benign Het
Trim30d T C 7: 104,483,336 K248R probably benign Het
Tspan12 C T 6: 21,772,919 M210I probably benign Het
Vmn2r11 T C 5: 109,053,423 Y405C probably damaging Het
Wdfy3 A G 5: 101,894,909 probably null Het
Wiz C A 17: 32,361,866 A83S probably damaging Het
Zmym6 T A 4: 127,123,544 Y947* probably null Het
Other mutations in Rps6ka2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01782:Rps6ka2 APN 17 7236124 missense probably benign 0.02
IGL02199:Rps6ka2 APN 17 7254453 splice site probably benign
IGL02458:Rps6ka2 APN 17 7289003 missense probably benign 0.04
IGL02532:Rps6ka2 APN 17 7255966 missense probably damaging 1.00
IGL02741:Rps6ka2 APN 17 7296016 missense probably benign 0.22
IGL02860:Rps6ka2 APN 17 7282856 missense possibly damaging 0.68
IGL02948:Rps6ka2 APN 17 7254450 critical splice donor site probably null
IGL03037:Rps6ka2 APN 17 7254450 critical splice donor site probably null
IGL03085:Rps6ka2 APN 17 7295280 critical splice donor site probably null
IGL03302:Rps6ka2 APN 17 7299388 missense possibly damaging 0.83
IGL03303:Rps6ka2 APN 17 7228012 nonsense probably null
R0083:Rps6ka2 UTSW 17 7296043 missense probably benign 0.33
R0108:Rps6ka2 UTSW 17 7296043 missense probably benign 0.33
R0145:Rps6ka2 UTSW 17 7262186 missense probably benign 0.09
R0257:Rps6ka2 UTSW 17 7227983 missense probably damaging 1.00
R0355:Rps6ka2 UTSW 17 7271610 missense probably benign 0.03
R0563:Rps6ka2 UTSW 17 7254437 missense probably damaging 1.00
R1065:Rps6ka2 UTSW 17 7281758 splice site probably benign
R1465:Rps6ka2 UTSW 17 7292867 missense probably damaging 1.00
R1465:Rps6ka2 UTSW 17 7292867 missense probably damaging 1.00
R1540:Rps6ka2 UTSW 17 7292906 missense probably null 1.00
R1708:Rps6ka2 UTSW 17 7277530 missense probably damaging 0.99
R2418:Rps6ka2 UTSW 17 7299339 missense possibly damaging 0.76
R2697:Rps6ka2 UTSW 17 7300322 missense probably benign 0.07
R4427:Rps6ka2 UTSW 17 7299405 missense possibly damaging 0.90
R4753:Rps6ka2 UTSW 17 7299308 missense possibly damaging 0.86
R4951:Rps6ka2 UTSW 17 7292789 missense probably damaging 1.00
R4954:Rps6ka2 UTSW 17 7271604 missense probably benign 0.00
R4954:Rps6ka2 UTSW 17 7299286 missense probably benign
R6298:Rps6ka2 UTSW 17 7170367 missense possibly damaging 0.92
R6800:Rps6ka2 UTSW 17 7251636 missense probably damaging 1.00
R6905:Rps6ka2 UTSW 17 7227941 missense probably damaging 1.00
R6952:Rps6ka2 UTSW 17 7227978 missense probably benign 0.00
R7268:Rps6ka2 UTSW 17 7295263 missense possibly damaging 0.80
R7278:Rps6ka2 UTSW 17 7271635 missense probably damaging 1.00
R7476:Rps6ka2 UTSW 17 7271633 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGAGTAGTGCTGTGTACG -3'
(R):5'- TAAGACACCAGGCCTTTCAAG -3'

Sequencing Primer
(F):5'- TGTACGTGAGGCCCATAGTC -3'
(R):5'- ACCAGGCCTTTCAAGCCCTG -3'
Posted On2019-05-13