Incidental Mutation 'R7015:4930523C07Rik'
ID545234
Institutional Source Beutler Lab
Gene Symbol 4930523C07Rik
Ensembl Gene ENSMUSG00000090394
Gene NameRIKEN cDNA 4930523C07 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R7015 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location160044382-160080208 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 160075168 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 3 (R3G)
Ref Sequence ENSEMBL: ENSMUSP00000137410 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097513]
Predicted Effect possibly damaging
Transcript: ENSMUST00000097513
AA Change: R3G

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000137410
Gene: ENSMUSG00000090394
AA Change: R3G

DomainStartEndE-ValueType
transmembrane domain 24 46 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 93% (55/59)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 A G 19: 43,798,178 I150V probably benign Het
Adgrb1 T C 15: 74,574,110 L1085P probably damaging Het
Agbl4 A G 4: 110,478,500 N24D probably damaging Het
Aox2 A G 1: 58,282,758 T70A probably benign Het
Aplf G A 6: 87,641,902 A399V probably damaging Het
Asxl3 A G 18: 22,523,921 S1663G probably benign Het
Bcat1 G C 6: 145,039,583 P43R probably damaging Het
Camk1 T C 6: 113,341,926 R9G probably benign Het
Casp8ap2 T C 4: 32,644,278 V1117A probably damaging Het
Cd300ld4 A T 11: 115,022,707 V174E probably benign Het
Cep85l T C 10: 53,349,055 D146G possibly damaging Het
Clip1 T C 5: 123,613,612 probably benign Het
Cog3 C T 14: 75,713,276 V719I possibly damaging Het
Col4a4 G A 1: 82,506,950 P532L unknown Het
Col6a4 C T 9: 106,033,755 probably null Het
Dync1h1 C T 12: 110,666,087 Q4547* probably null Het
Ergic1 G A 17: 26,654,879 probably benign Het
Foxn4 G A 5: 114,256,855 T337M possibly damaging Het
Gemin5 A T 11: 58,156,740 I336N probably damaging Het
Gm21905 A T 5: 67,946,362 probably null Het
Grik2 C A 10: 49,535,436 R202L probably damaging Het
Iglon5 T C 7: 43,476,927 D184G probably benign Het
Il11ra1 A T 4: 41,765,421 Q172L probably benign Het
Me2 G T 18: 73,781,147 probably null Het
Med24 A G 11: 98,718,852 V73A possibly damaging Het
Mmp24 A G 2: 155,792,624 Q88R probably damaging Het
Mroh3 A T 1: 136,183,331 V819E probably damaging Het
Mrps9 A G 1: 42,898,546 K247R probably benign Het
Myo15b G A 11: 115,871,844 R1254H Het
Ncoa5 A G 2: 165,002,081 L134P probably benign Het
Olfr628 T C 7: 103,732,817 V297A probably null Het
Olfr78 C A 7: 102,742,444 L186F probably damaging Het
Olfr984 A T 9: 40,101,455 F12I probably benign Het
Pdcd11 A G 19: 47,098,226 I224V probably benign Het
Ptprh C A 7: 4,552,627 probably null Het
Rab34 G T 11: 78,190,152 V63F probably damaging Het
Rack1 T C 11: 48,801,765 I71T probably benign Het
Rai14 G A 15: 10,589,315 R266* probably null Het
Rsph9 A G 17: 46,129,456 V238A probably benign Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Sel1l3 A T 5: 53,172,574 C480S probably benign Het
Sh3pxd2a C T 19: 47,268,123 A747T probably benign Het
Slc1a3 T C 15: 8,649,568 N181S probably damaging Het
Slit1 T A 19: 41,629,886 K784* probably null Het
Sos2 T A 12: 69,585,235 Q1297L probably benign Het
Srd5a2 T A 17: 74,027,119 T102S probably benign Het
Ss18l2 A T 9: 121,712,608 I64F probably damaging Het
Tas2r120 T C 6: 132,657,165 F70S possibly damaging Het
Tjap1 G A 17: 46,263,774 A5V possibly damaging Het
Tln2 A T 9: 67,362,647 M488K possibly damaging Het
Tnks T G 8: 34,838,547 I42L probably benign Het
Togaram2 A T 17: 71,709,568 Q640L possibly damaging Het
Triobp C A 15: 78,994,060 Q1682K probably damaging Het
Trip11 C T 12: 101,893,683 E311K probably damaging Het
Ugt2b5 A G 5: 87,139,796 Y171H probably damaging Het
Vmn2r66 T C 7: 84,995,558 D548G possibly damaging Het
Zfp990 G T 4: 145,536,635 D68Y probably damaging Het
Zranb2 A T 3: 157,536,733 probably null Het
Other mutations in 4930523C07Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02545:4930523C07Rik APN 1 160075424 missense probably damaging 0.97
R1023:4930523C07Rik UTSW 1 160077487 unclassified probably benign
R1707:4930523C07Rik UTSW 1 160070802 unclassified probably benign
R2128:4930523C07Rik UTSW 1 160075375 nonsense probably null
R2129:4930523C07Rik UTSW 1 160075375 nonsense probably null
R2147:4930523C07Rik UTSW 1 160075433 missense probably benign 0.04
R4135:4930523C07Rik UTSW 1 160077522 unclassified probably benign
R4418:4930523C07Rik UTSW 1 160044802 unclassified noncoding transcript
R4431:4930523C07Rik UTSW 1 160044579 unclassified noncoding transcript
R5222:4930523C07Rik UTSW 1 160044608 unclassified noncoding transcript
R6170:4930523C07Rik UTSW 1 160075173 missense possibly damaging 0.82
R6248:4930523C07Rik UTSW 1 160075408 missense possibly damaging 0.83
R6612:4930523C07Rik UTSW 1 160075234 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GCATAAAGACACGGACACTATG -3'
(R):5'- AGCAGAGATCCAGAGGTCTTC -3'

Sequencing Primer
(F):5'- GAAAATAGACAGACCATTGCTATTGC -3'
(R):5'- AGAGATCCAGAGGTCTTCATCTTTC -3'
Posted On2019-05-13