Incidental Mutation 'R7016:Hnf4a'
ID545293
Institutional Source Beutler Lab
Gene Symbol Hnf4a
Ensembl Gene ENSMUSG00000017950
Gene Namehepatic nuclear factor 4, alpha
SynonymsHNF-4, HNF4 alpha, Nuclear receptor 2A1, Tcf14, Nr2a1, MODY1, Tcf4, Hnf4
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7016 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location163506808-163572910 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 163564273 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 277 (Y277N)
Ref Sequence ENSEMBL: ENSMUSP00000105038 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018094] [ENSMUST00000109411]
Predicted Effect probably damaging
Transcript: ENSMUST00000018094
AA Change: Y286N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000018094
Gene: ENSMUSG00000017950
AA Change: Y286N

DomainStartEndE-ValueType
ZnF_C4 57 128 7.83e-38 SMART
HOLI 189 348 1.12e-47 SMART
low complexity region 383 393 N/A INTRINSIC
low complexity region 426 445 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109411
AA Change: Y277N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105038
Gene: ENSMUSG00000017950
AA Change: Y277N

DomainStartEndE-ValueType
ZnF_C4 48 119 7.83e-38 SMART
HOLI 180 339 1.12e-47 SMART
low complexity region 374 384 N/A INTRINSIC
low complexity region 417 436 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: The protein encoded by this gene is a transcription factor involved in the development of the pancreas, liver, kidney, and intestines. The encoded protein also functions to maintain glucose homeostasis. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2015]
PHENOTYPE: Nullizygous embryos show delayed growth and lethality, impaired gastrulation, abnormal primitive streak and mesoderm formation, ectoderm apoptosis, and extraembryonic tissue dysplasia. Mice expressing only the alpha1 isoform show glucose intolerance whereas mice expressing alpha7 show dyslipidemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810043G02Rik T A 10: 77,982,956 C154S probably benign Het
Abcb4 T A 5: 8,936,843 V754D probably benign Het
Actn1 T A 12: 80,172,968 M710L possibly damaging Het
Adam1a A G 5: 121,521,038 F64S probably benign Het
Aip G T 19: 4,121,402 D11E probably benign Het
Ak7 T A 12: 105,781,679 Y714* probably null Het
Amhr2 A G 15: 102,454,364 E522G possibly damaging Het
Amotl1 A G 9: 14,593,699 L108P probably damaging Het
Arhgef17 A G 7: 100,878,977 S677P probably benign Het
Asph T C 4: 9,630,604 probably null Het
Atp11b T C 3: 35,841,036 S908P probably benign Het
Atp13a3 C A 16: 30,338,490 V903L possibly damaging Het
Bcam G A 7: 19,758,443 R576* probably null Het
Btbd2 A G 10: 80,648,615 S141P probably damaging Het
Cacna1b T C 2: 24,762,848 N67S possibly damaging Het
Cc2d2b A G 19: 40,795,804 T872A possibly damaging Het
Ccdc24 T A 4: 117,871,116 I144F probably null Het
Cep44 A T 8: 56,544,199 F101L possibly damaging Het
Disp1 C A 1: 183,087,466 R1130L probably damaging Het
Dnajc21 G T 15: 10,461,407 Y152* probably null Het
Edem2 A G 2: 155,716,072 F214L possibly damaging Het
Fam118b G A 9: 35,223,718 R198W probably damaging Het
Fam208b A T 13: 3,576,857 V1031E possibly damaging Het
Fgb A G 3: 83,046,064 V133A probably benign Het
Fsip2 A G 2: 82,990,635 T5571A probably benign Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,817 probably benign Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,266,277 probably benign Het
Hjurp TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTGCT TCT 1: 88,266,278 probably benign Het
Htatip2 A G 7: 49,770,835 D143G possibly damaging Het
Itgae A G 11: 73,119,516 N611D probably damaging Het
Ksr1 A T 11: 79,027,536 N515K probably damaging Het
Lrp1 C A 10: 127,559,967 probably null Het
Map3k20 T A 2: 72,378,635 V195D probably damaging Het
Meox2 A G 12: 37,109,224 S132G probably benign Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Nell2 T A 15: 95,229,151 N781I possibly damaging Het
Odf3l2 T C 10: 79,639,956 Y258C probably damaging Het
Olfr106-ps G A 17: 37,395,203 G221D possibly damaging Het
Olfr513 A G 7: 108,755,711 N285S probably damaging Het
Olfr535 A G 7: 140,493,240 T201A probably benign Het
Olfr631 A G 7: 103,929,530 I236V probably benign Het
Otoa A T 7: 121,147,766 Q918L probably damaging Het
Palld T G 8: 61,515,998 K1022T probably damaging Het
Parp8 A T 13: 116,895,091 S362T probably damaging Het
Phrf1 A G 7: 141,237,563 E95G probably damaging Het
Pls1 A T 9: 95,786,941 F76I probably damaging Het
Pnp T A 14: 50,950,249 probably null Het
Ptdss1 A C 13: 66,972,621 M294L probably benign Het
Rictor T A 15: 6,774,880 probably null Het
Rilp A G 11: 75,510,919 E175G probably damaging Het
Serpina16 T A 12: 103,675,371 T32S probably benign Het
Sim1 C T 10: 50,984,250 S736L probably benign Het
Smarcc2 T G 10: 128,485,329 probably null Het
Smtn A G 11: 3,530,368 probably null Het
Sspo T A 6: 48,449,164 W98R probably damaging Het
St8sia3 A T 18: 64,269,583 I98F probably benign Het
Taf10 A T 7: 105,743,998 probably null Het
Tbc1d4 T A 14: 101,487,441 N580I probably damaging Het
Trim12c A T 7: 104,348,206 C48S Het
Tsc22d1 C A 14: 76,417,542 T405K probably damaging Het
Tubgcp5 A G 7: 55,794,229 D2G possibly damaging Het
Wwc2 T C 8: 47,847,548 E960G unknown Het
Yme1l1 T A 2: 23,186,355 probably null Het
Zbtb2 G C 10: 4,368,646 P460R probably damaging Het
Zfp62 T G 11: 49,215,937 I285S probably damaging Het
Other mutations in Hnf4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01393:Hnf4a APN 2 163551572 splice site probably benign
IGL02077:Hnf4a APN 2 163562607 critical splice donor site probably null
IGL02419:Hnf4a APN 2 163566282 missense probably damaging 1.00
IGL02931:Hnf4a APN 2 163566117 splice site probably benign
R0230:Hnf4a UTSW 2 163559085 missense probably damaging 1.00
R1670:Hnf4a UTSW 2 163562576 missense probably damaging 1.00
R1743:Hnf4a UTSW 2 163566339 missense possibly damaging 0.65
R2131:Hnf4a UTSW 2 163547418 missense probably benign 0.10
R2509:Hnf4a UTSW 2 163566241 missense probably damaging 1.00
R4209:Hnf4a UTSW 2 163568889 missense probably benign 0.00
R4737:Hnf4a UTSW 2 163564219 missense probably benign 0.05
R5478:Hnf4a UTSW 2 163569006 missense probably benign
R6382:Hnf4a UTSW 2 163569006 missense probably benign
Predicted Primers PCR Primer
(F):5'- AATTGCAAACCATAACCAGGGG -3'
(R):5'- GCTGTTCTGAGAAGTCCTTCC -3'

Sequencing Primer
(F):5'- TTGCAAACCATAACCAGGGGGATAG -3'
(R):5'- TGAGAAGTCCTTCCTCCCTGGG -3'
Posted On2019-05-13