Incidental Mutation 'R7016:Bcam'
ID545300
Institutional Source Beutler Lab
Gene Symbol Bcam
Ensembl Gene ENSMUSG00000002980
Gene Namebasal cell adhesion molecule
Synonyms1200005K12Rik, Lu, B-CAM
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7016 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location19756131-19771016 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 19758443 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 576 (R576*)
Ref Sequence ENSEMBL: ENSMUSP00000003061 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003061]
Predicted Effect probably null
Transcript: ENSMUST00000003061
AA Change: R576*
SMART Domains Protein: ENSMUSP00000003061
Gene: ENSMUSG00000002980
AA Change: R576*

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
IG 32 137 3.1e-9 SMART
IG_like 174 254 1.89e1 SMART
IGc2 275 337 2.58e-6 SMART
IGc2 369 425 2.16e-8 SMART
IG_like 458 523 7.29e-2 SMART
transmembrane domain 541 563 N/A INTRINSIC
low complexity region 601 619 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes Lutheran blood group glycoprotein, a member of the immunoglobulin superfamily and a receptor for the extracellular matrix protein, laminin. The protein contains five extracellular immunoglobulin domains, a single transmembrane domain, and a short C-terminal cytoplasmic tail. This protein may play a role in epithelial cell cancer and in vaso-occlusion of red blood cells in sickle cell disease. Polymorphisms in this gene define some of the antigens in the Lutheran system and also the Auberger system. Inactivating variants of this gene result in the recessive Lutheran null phenotype, Lu(a-b-), of the Lutheran blood group. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: A gene trap insertion into an intron of this gene results in no obvious phenotype. Mice homozygous for a null allele exhibit glomeruli abnormalities and increased thickness and disorganization of intestinal smooth muscle. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810043G02Rik T A 10: 77,982,956 C154S probably benign Het
Abcb4 T A 5: 8,936,843 V754D probably benign Het
Actn1 T A 12: 80,172,968 M710L possibly damaging Het
Adam1a A G 5: 121,521,038 F64S probably benign Het
Aip G T 19: 4,121,402 D11E probably benign Het
Ak7 T A 12: 105,781,679 Y714* probably null Het
Amhr2 A G 15: 102,454,364 E522G possibly damaging Het
Amotl1 A G 9: 14,593,699 L108P probably damaging Het
Arhgef17 A G 7: 100,878,977 S677P probably benign Het
Asph T C 4: 9,630,604 probably null Het
Atp11b T C 3: 35,841,036 S908P probably benign Het
Atp13a3 C A 16: 30,338,490 V903L possibly damaging Het
Btbd2 A G 10: 80,648,615 S141P probably damaging Het
Cacna1b T C 2: 24,762,848 N67S possibly damaging Het
Cc2d2b A G 19: 40,795,804 T872A possibly damaging Het
Ccdc24 T A 4: 117,871,116 I144F probably null Het
Cep44 A T 8: 56,544,199 F101L possibly damaging Het
Disp1 C A 1: 183,087,466 R1130L probably damaging Het
Dnajc21 G T 15: 10,461,407 Y152* probably null Het
Edem2 A G 2: 155,716,072 F214L possibly damaging Het
Fam118b G A 9: 35,223,718 R198W probably damaging Het
Fam208b A T 13: 3,576,857 V1031E possibly damaging Het
Fgb A G 3: 83,046,064 V133A probably benign Het
Fsip2 A G 2: 82,990,635 T5571A probably benign Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,817 probably benign Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,266,277 probably benign Het
Hjurp TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTGCT TCT 1: 88,266,278 probably benign Het
Hnf4a T A 2: 163,564,273 Y277N probably damaging Het
Htatip2 A G 7: 49,770,835 D143G possibly damaging Het
Itgae A G 11: 73,119,516 N611D probably damaging Het
Ksr1 A T 11: 79,027,536 N515K probably damaging Het
Lrp1 C A 10: 127,559,967 probably null Het
Map3k20 T A 2: 72,378,635 V195D probably damaging Het
Meox2 A G 12: 37,109,224 S132G probably benign Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Nell2 T A 15: 95,229,151 N781I possibly damaging Het
Odf3l2 T C 10: 79,639,956 Y258C probably damaging Het
Olfr106-ps G A 17: 37,395,203 G221D possibly damaging Het
Olfr513 A G 7: 108,755,711 N285S probably damaging Het
Olfr535 A G 7: 140,493,240 T201A probably benign Het
Olfr631 A G 7: 103,929,530 I236V probably benign Het
Otoa A T 7: 121,147,766 Q918L probably damaging Het
Palld T G 8: 61,515,998 K1022T probably damaging Het
Parp8 A T 13: 116,895,091 S362T probably damaging Het
Phrf1 A G 7: 141,237,563 E95G probably damaging Het
Pls1 A T 9: 95,786,941 F76I probably damaging Het
Pnp T A 14: 50,950,249 probably null Het
Ptdss1 A C 13: 66,972,621 M294L probably benign Het
Rictor T A 15: 6,774,880 probably null Het
Rilp A G 11: 75,510,919 E175G probably damaging Het
Serpina16 T A 12: 103,675,371 T32S probably benign Het
Sim1 C T 10: 50,984,250 S736L probably benign Het
Smarcc2 T G 10: 128,485,329 probably null Het
Smtn A G 11: 3,530,368 probably null Het
Sspo T A 6: 48,449,164 W98R probably damaging Het
St8sia3 A T 18: 64,269,583 I98F probably benign Het
Taf10 A T 7: 105,743,998 probably null Het
Tbc1d4 T A 14: 101,487,441 N580I probably damaging Het
Trim12c A T 7: 104,348,206 C48S Het
Tsc22d1 C A 14: 76,417,542 T405K probably damaging Het
Tubgcp5 A G 7: 55,794,229 D2G possibly damaging Het
Wwc2 T C 8: 47,847,548 E960G unknown Het
Yme1l1 T A 2: 23,186,355 probably null Het
Zbtb2 G C 10: 4,368,646 P460R probably damaging Het
Zfp62 T G 11: 49,215,937 I285S probably damaging Het
Other mutations in Bcam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01065:Bcam APN 7 19756799 missense probably benign 0.02
IGL01433:Bcam APN 7 19760182 missense possibly damaging 0.75
IGL01712:Bcam APN 7 19758767 missense probably damaging 0.99
IGL01943:Bcam APN 7 19765498 missense probably damaging 1.00
IGL01946:Bcam APN 7 19760117 nonsense probably null
IGL02281:Bcam APN 7 19758691 missense probably damaging 1.00
IGL02714:Bcam APN 7 19758807 splice site probably benign
IGL02837:Bcam UTSW 7 19764186 missense probably damaging 1.00
PIT4514001:Bcam UTSW 7 19764066 missense probably benign 0.06
R0063:Bcam UTSW 7 19766848 missense probably benign 0.21
R0063:Bcam UTSW 7 19766848 missense probably benign 0.21
R1500:Bcam UTSW 7 19758964 missense possibly damaging 0.75
R1575:Bcam UTSW 7 19760382 missense possibly damaging 0.87
R1585:Bcam UTSW 7 19760186 missense probably damaging 1.00
R1768:Bcam UTSW 7 19765618 missense probably null 1.00
R1813:Bcam UTSW 7 19766715 missense probably damaging 1.00
R1896:Bcam UTSW 7 19766715 missense probably damaging 1.00
R2016:Bcam UTSW 7 19760349 missense probably benign 0.38
R2117:Bcam UTSW 7 19758427 missense possibly damaging 0.71
R3713:Bcam UTSW 7 19764193 missense probably benign 0.12
R3917:Bcam UTSW 7 19765450 missense probably damaging 1.00
R4596:Bcam UTSW 7 19764157 missense probably damaging 0.97
R4866:Bcam UTSW 7 19765472 missense probably benign 0.00
R4874:Bcam UTSW 7 19769322 intron probably benign
R5054:Bcam UTSW 7 19756860 intron probably benign
R5062:Bcam UTSW 7 19760101 missense possibly damaging 0.62
R6783:Bcam UTSW 7 19766881 missense probably damaging 1.00
R6853:Bcam UTSW 7 19760406 missense probably damaging 1.00
R7174:Bcam UTSW 7 19765451 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGCCCTGCAATGGAGAATG -3'
(R):5'- GGCCATGTCTTCCACTTTGG -3'

Sequencing Primer
(F):5'- CCCTGCAATGGAGAATGGTAGG -3'
(R):5'- CAGCGGAGTAGACACGC -3'
Posted On2019-05-13