Incidental Mutation 'R7016:Wwc2'
ID545311
Institutional Source Beutler Lab
Gene Symbol Wwc2
Ensembl Gene ENSMUSG00000031563
Gene NameWW, C2 and coiled-coil domain containing 2
SynonymsD8Ertd594e
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.349) question?
Stock #R7016 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location47823959-47990924 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 47847548 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 960 (E960G)
Ref Sequence ENSEMBL: ENSMUSP00000056121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057561]
Predicted Effect unknown
Transcript: ENSMUST00000057561
AA Change: E960G
SMART Domains Protein: ENSMUSP00000056121
Gene: ENSMUSG00000031563
AA Change: E960G

DomainStartEndE-ValueType
WW 11 43 3.92e-11 SMART
WW 58 90 4.65e-4 SMART
low complexity region 143 156 N/A INTRINSIC
coiled coil region 162 194 N/A INTRINSIC
coiled coil region 223 254 N/A INTRINSIC
coiled coil region 302 333 N/A INTRINSIC
low complexity region 341 358 N/A INTRINSIC
coiled coil region 359 423 N/A INTRINSIC
low complexity region 540 567 N/A INTRINSIC
C2 713 818 5.29e0 SMART
coiled coil region 857 884 N/A INTRINSIC
coiled coil region 1067 1144 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WW-and-C2-domain-containing family of proteins. Members of this family have two N-terminal WW domains that mediate binding to target proteins harboring L/PPxY motifs, an internal C2 domain for membrane association, and C-terminal alpha protein kinase C binding sites and class III PDZ domain-interaction motifs. Proteins of this family are able to form homo- and heterodimers and to modulate hippo pathway signaling. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810043G02Rik T A 10: 77,982,956 C154S probably benign Het
Abcb4 T A 5: 8,936,843 V754D probably benign Het
Actn1 T A 12: 80,172,968 M710L possibly damaging Het
Adam1a A G 5: 121,521,038 F64S probably benign Het
Aip G T 19: 4,121,402 D11E probably benign Het
Ak7 T A 12: 105,781,679 Y714* probably null Het
Amhr2 A G 15: 102,454,364 E522G possibly damaging Het
Amotl1 A G 9: 14,593,699 L108P probably damaging Het
Arhgef17 A G 7: 100,878,977 S677P probably benign Het
Asph T C 4: 9,630,604 probably null Het
Atp11b T C 3: 35,841,036 S908P probably benign Het
Atp13a3 C A 16: 30,338,490 V903L possibly damaging Het
Bcam G A 7: 19,758,443 R576* probably null Het
Btbd2 A G 10: 80,648,615 S141P probably damaging Het
Cacna1b T C 2: 24,762,848 N67S possibly damaging Het
Cc2d2b A G 19: 40,795,804 T872A possibly damaging Het
Ccdc24 T A 4: 117,871,116 I144F probably null Het
Cep44 A T 8: 56,544,199 F101L possibly damaging Het
Disp1 C A 1: 183,087,466 R1130L probably damaging Het
Dnajc21 G T 15: 10,461,407 Y152* probably null Het
Edem2 A G 2: 155,716,072 F214L possibly damaging Het
Fam118b G A 9: 35,223,718 R198W probably damaging Het
Fam208b A T 13: 3,576,857 V1031E possibly damaging Het
Fgb A G 3: 83,046,064 V133A probably benign Het
Fsip2 A G 2: 82,990,635 T5571A probably benign Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,817 probably benign Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,266,277 probably benign Het
Hjurp TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTGCT TCT 1: 88,266,278 probably benign Het
Hnf4a T A 2: 163,564,273 Y277N probably damaging Het
Htatip2 A G 7: 49,770,835 D143G possibly damaging Het
Itgae A G 11: 73,119,516 N611D probably damaging Het
Ksr1 A T 11: 79,027,536 N515K probably damaging Het
Lrp1 C A 10: 127,559,967 probably null Het
Map3k20 T A 2: 72,378,635 V195D probably damaging Het
Meox2 A G 12: 37,109,224 S132G probably benign Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Nell2 T A 15: 95,229,151 N781I possibly damaging Het
Odf3l2 T C 10: 79,639,956 Y258C probably damaging Het
Olfr106-ps G A 17: 37,395,203 G221D possibly damaging Het
Olfr513 A G 7: 108,755,711 N285S probably damaging Het
Olfr535 A G 7: 140,493,240 T201A probably benign Het
Olfr631 A G 7: 103,929,530 I236V probably benign Het
Otoa A T 7: 121,147,766 Q918L probably damaging Het
Palld T G 8: 61,515,998 K1022T probably damaging Het
Parp8 A T 13: 116,895,091 S362T probably damaging Het
Phrf1 A G 7: 141,237,563 E95G probably damaging Het
Pls1 A T 9: 95,786,941 F76I probably damaging Het
Pnp T A 14: 50,950,249 probably null Het
Ptdss1 A C 13: 66,972,621 M294L probably benign Het
Rictor T A 15: 6,774,880 probably null Het
Rilp A G 11: 75,510,919 E175G probably damaging Het
Serpina16 T A 12: 103,675,371 T32S probably benign Het
Sim1 C T 10: 50,984,250 S736L probably benign Het
Smarcc2 T G 10: 128,485,329 probably null Het
Smtn A G 11: 3,530,368 probably null Het
Sspo T A 6: 48,449,164 W98R probably damaging Het
St8sia3 A T 18: 64,269,583 I98F probably benign Het
Taf10 A T 7: 105,743,998 probably null Het
Tbc1d4 T A 14: 101,487,441 N580I probably damaging Het
Trim12c A T 7: 104,348,206 C48S Het
Tsc22d1 C A 14: 76,417,542 T405K probably damaging Het
Tubgcp5 A G 7: 55,794,229 D2G possibly damaging Het
Yme1l1 T A 2: 23,186,355 probably null Het
Zbtb2 G C 10: 4,368,646 P460R probably damaging Het
Zfp62 T G 11: 49,215,937 I285S probably damaging Het
Other mutations in Wwc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00969:Wwc2 APN 8 47846158 missense unknown
IGL01397:Wwc2 APN 8 47868276 missense unknown
IGL01522:Wwc2 APN 8 47868633 missense unknown
IGL01530:Wwc2 APN 8 47863939 missense unknown
IGL01867:Wwc2 APN 8 47883580 missense probably benign 0.02
IGL01991:Wwc2 APN 8 47869866 nonsense probably null
IGL02092:Wwc2 APN 8 47864535 missense unknown
IGL02320:Wwc2 APN 8 47863847 splice site probably null
IGL02503:Wwc2 APN 8 47849383 missense unknown
H8562:Wwc2 UTSW 8 47920666 missense possibly damaging 0.77
R0244:Wwc2 UTSW 8 47900721 missense probably benign 0.16
R0331:Wwc2 UTSW 8 47880204 missense probably benign 0.15
R0349:Wwc2 UTSW 8 47868666 missense unknown
R0542:Wwc2 UTSW 8 47868379 missense unknown
R0645:Wwc2 UTSW 8 47900639 splice site probably benign
R1081:Wwc2 UTSW 8 47828764 unclassified probably benign
R1167:Wwc2 UTSW 8 47858779 nonsense probably null
R1646:Wwc2 UTSW 8 47842902 missense unknown
R1860:Wwc2 UTSW 8 47990102 missense possibly damaging 0.90
R2070:Wwc2 UTSW 8 47868321 missense unknown
R2183:Wwc2 UTSW 8 47842926 missense unknown
R3969:Wwc2 UTSW 8 47856323 missense unknown
R4096:Wwc2 UTSW 8 47842902 missense unknown
R4387:Wwc2 UTSW 8 47831646 missense unknown
R4447:Wwc2 UTSW 8 47868667 missense unknown
R4448:Wwc2 UTSW 8 47868667 missense unknown
R4450:Wwc2 UTSW 8 47868667 missense unknown
R4646:Wwc2 UTSW 8 47920601 missense probably damaging 1.00
R4869:Wwc2 UTSW 8 47920678 missense probably damaging 0.99
R5159:Wwc2 UTSW 8 47900761 missense probably benign 0.03
R5317:Wwc2 UTSW 8 47847555 missense unknown
R5391:Wwc2 UTSW 8 47863871 missense unknown
R5728:Wwc2 UTSW 8 47864061 missense unknown
R5871:Wwc2 UTSW 8 47868423 missense unknown
R5943:Wwc2 UTSW 8 47990102 missense possibly damaging 0.90
R6137:Wwc2 UTSW 8 47856263 missense unknown
R6169:Wwc2 UTSW 8 47858843 missense unknown
R6363:Wwc2 UTSW 8 47887162 splice site probably null
R6421:Wwc2 UTSW 8 47900746 missense probably damaging 1.00
R6467:Wwc2 UTSW 8 47851908 missense unknown
R6712:Wwc2 UTSW 8 47900803 missense probably benign 0.42
R6765:Wwc2 UTSW 8 47900791 missense possibly damaging 0.85
R6766:Wwc2 UTSW 8 47900791 missense possibly damaging 0.85
R6767:Wwc2 UTSW 8 47900791 missense possibly damaging 0.85
R6768:Wwc2 UTSW 8 47900791 missense possibly damaging 0.85
R6782:Wwc2 UTSW 8 47900791 missense possibly damaging 0.85
R6993:Wwc2 UTSW 8 47847465 missense unknown
R7079:Wwc2 UTSW 8 47847545 missense unknown
R7219:Wwc2 UTSW 8 47858884 missense unknown
R7258:Wwc2 UTSW 8 47842999 missense unknown
Predicted Primers PCR Primer
(F):5'- TCTACTCAGTGAGCTCTGCAG -3'
(R):5'- GTAGAAAGCCACTTCCCCTCTC -3'

Sequencing Primer
(F):5'- GGCACAGTCTCTGCTCTCAG -3'
(R):5'- CTACTTTCTACAGCATGGTTCTCTG -3'
Posted On2019-05-13