Incidental Mutation 'R7016:Mmp1a'
ID545314
Institutional Source Beutler Lab
Gene Symbol Mmp1a
Ensembl Gene ENSMUSG00000043089
Gene Namematrix metallopeptidase 1a (interstitial collagenase)
SynonymsMcol-A
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R7016 (G1)
Quality Score214.458
Status Not validated
Chromosome9
Chromosomal Location7464141-7476869 bp(+) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) TG to TGG at 7465083 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151193 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034492] [ENSMUST00000217651]
Predicted Effect probably null
Transcript: ENSMUST00000034492
SMART Domains Protein: ENSMUSP00000034492
Gene: ENSMUSG00000043089

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:PG_binding_1 25 84 8.2e-14 PFAM
ZnMc 97 259 2.99e-44 SMART
HX 281 323 8.12e-6 SMART
HX 325 369 7.81e-8 SMART
HX 374 421 5.82e-16 SMART
HX 423 463 2.18e0 SMART
Predicted Effect probably null
Transcript: ENSMUST00000217651
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: This gene encodes a member of the matrix metalloproteinase family of extracellular matrix-degrading enzymes that are involved in tissue remodeling, wound repair, progression of atherosclerosis and tumor invasion. The encoded preproprotein undergoes proteolytic processing to generate a mature, zinc-dependent endopeptidase enzyme that degrades collagens. Mice lacking the encoded protein exhibit decreased susceptibility to chemical carcinogen-induced lung tumor development and angiogenesis. This gene is located in a cluster of other matrix metalloproteinase genes on chromosome 9. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced inflammatory response following chemical induction of tumors and male mice exhibit fewer large induced tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810043G02Rik T A 10: 77,982,956 C154S probably benign Het
Abcb4 T A 5: 8,936,843 V754D probably benign Het
Actn1 T A 12: 80,172,968 M710L possibly damaging Het
Adam1a A G 5: 121,521,038 F64S probably benign Het
Aip G T 19: 4,121,402 D11E probably benign Het
Ak7 T A 12: 105,781,679 Y714* probably null Het
Amhr2 A G 15: 102,454,364 E522G possibly damaging Het
Amotl1 A G 9: 14,593,699 L108P probably damaging Het
Arhgef17 A G 7: 100,878,977 S677P probably benign Het
Asph T C 4: 9,630,604 probably null Het
Atp11b T C 3: 35,841,036 S908P probably benign Het
Atp13a3 C A 16: 30,338,490 V903L possibly damaging Het
Bcam G A 7: 19,758,443 R576* probably null Het
Btbd2 A G 10: 80,648,615 S141P probably damaging Het
Cacna1b T C 2: 24,762,848 N67S possibly damaging Het
Cc2d2b A G 19: 40,795,804 T872A possibly damaging Het
Ccdc24 T A 4: 117,871,116 I144F probably null Het
Cep44 A T 8: 56,544,199 F101L possibly damaging Het
Disp1 C A 1: 183,087,466 R1130L probably damaging Het
Dnajc21 G T 15: 10,461,407 Y152* probably null Het
Edem2 A G 2: 155,716,072 F214L possibly damaging Het
Fam118b G A 9: 35,223,718 R198W probably damaging Het
Fam208b A T 13: 3,576,857 V1031E possibly damaging Het
Fgb A G 3: 83,046,064 V133A probably benign Het
Fsip2 A G 2: 82,990,635 T5571A probably benign Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,817 probably benign Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,266,277 probably benign Het
Hjurp TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTGCT TCT 1: 88,266,278 probably benign Het
Hnf4a T A 2: 163,564,273 Y277N probably damaging Het
Htatip2 A G 7: 49,770,835 D143G possibly damaging Het
Itgae A G 11: 73,119,516 N611D probably damaging Het
Ksr1 A T 11: 79,027,536 N515K probably damaging Het
Lrp1 C A 10: 127,559,967 probably null Het
Map3k20 T A 2: 72,378,635 V195D probably damaging Het
Meox2 A G 12: 37,109,224 S132G probably benign Het
Nell2 T A 15: 95,229,151 N781I possibly damaging Het
Odf3l2 T C 10: 79,639,956 Y258C probably damaging Het
Olfr106-ps G A 17: 37,395,203 G221D possibly damaging Het
Olfr513 A G 7: 108,755,711 N285S probably damaging Het
Olfr535 A G 7: 140,493,240 T201A probably benign Het
Olfr631 A G 7: 103,929,530 I236V probably benign Het
Otoa A T 7: 121,147,766 Q918L probably damaging Het
Palld T G 8: 61,515,998 K1022T probably damaging Het
Parp8 A T 13: 116,895,091 S362T probably damaging Het
Phrf1 A G 7: 141,237,563 E95G probably damaging Het
Pls1 A T 9: 95,786,941 F76I probably damaging Het
Pnp T A 14: 50,950,249 probably null Het
Ptdss1 A C 13: 66,972,621 M294L probably benign Het
Rictor T A 15: 6,774,880 probably null Het
Rilp A G 11: 75,510,919 E175G probably damaging Het
Serpina16 T A 12: 103,675,371 T32S probably benign Het
Sim1 C T 10: 50,984,250 S736L probably benign Het
Smarcc2 T G 10: 128,485,329 probably null Het
Smtn A G 11: 3,530,368 probably null Het
Sspo T A 6: 48,449,164 W98R probably damaging Het
St8sia3 A T 18: 64,269,583 I98F probably benign Het
Taf10 A T 7: 105,743,998 probably null Het
Tbc1d4 T A 14: 101,487,441 N580I probably damaging Het
Trim12c A T 7: 104,348,206 C48S Het
Tsc22d1 C A 14: 76,417,542 T405K probably damaging Het
Tubgcp5 A G 7: 55,794,229 D2G possibly damaging Het
Wwc2 T C 8: 47,847,548 E960G unknown Het
Yme1l1 T A 2: 23,186,355 probably null Het
Zbtb2 G C 10: 4,368,646 P460R probably damaging Het
Zfp62 T G 11: 49,215,937 I285S probably damaging Het
Other mutations in Mmp1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00477:Mmp1a APN 9 7476259 missense probably benign 0.04
IGL02179:Mmp1a APN 9 7464273 missense probably benign 0.23
IGL02738:Mmp1a APN 9 7464301 splice site probably benign
IGL02984:Mmp1a UTSW 9 7465083 makesense probably null
IGL02988:Mmp1a UTSW 9 7465083 makesense probably null
IGL02991:Mmp1a UTSW 9 7465083 makesense probably null
IGL03014:Mmp1a UTSW 9 7465083 makesense probably null
IGL03050:Mmp1a UTSW 9 7465083 makesense probably null
IGL03054:Mmp1a UTSW 9 7465083 makesense probably null
IGL03055:Mmp1a UTSW 9 7465083 makesense probably null
IGL03097:Mmp1a UTSW 9 7465083 makesense probably null
IGL03098:Mmp1a UTSW 9 7465083 makesense probably null
IGL03134:Mmp1a UTSW 9 7465083 makesense probably null
IGL03138:Mmp1a UTSW 9 7465083 makesense probably null
IGL03147:Mmp1a UTSW 9 7465083 makesense probably null
R0095:Mmp1a UTSW 9 7465620 missense possibly damaging 0.51
R0095:Mmp1a UTSW 9 7465620 missense possibly damaging 0.51
R1422:Mmp1a UTSW 9 7464298 splice site probably null
R1663:Mmp1a UTSW 9 7465656 missense probably benign 0.33
R1801:Mmp1a UTSW 9 7475390 missense probably damaging 1.00
R2171:Mmp1a UTSW 9 7475356 missense probably damaging 0.99
R3415:Mmp1a UTSW 9 7464869 missense possibly damaging 0.92
R3901:Mmp1a UTSW 9 7475345 makesense probably null
R4175:Mmp1a UTSW 9 7467235 missense probably benign 0.03
R5406:Mmp1a UTSW 9 7467293 missense probably damaging 1.00
R6462:Mmp1a UTSW 9 7467038 missense probably benign 0.01
R7039:Mmp1a UTSW 9 7465083 makesense probably null
R7098:Mmp1a UTSW 9 7475937 missense probably benign 0.00
R7144:Mmp1a UTSW 9 7475318 missense probably damaging 1.00
R7196:Mmp1a UTSW 9 7476017 nonsense probably null
R7284:Mmp1a UTSW 9 7465083 makesense probably null
R7289:Mmp1a UTSW 9 7467293 missense probably damaging 1.00
R7313:Mmp1a UTSW 9 7465083 makesense probably null
X0020:Mmp1a UTSW 9 7465626 missense probably damaging 1.00
Predicted Primers
Posted On2019-05-13