Incidental Mutation 'R7016:Pls1'
ID545317
Institutional Source Beutler Lab
Gene Symbol Pls1
Ensembl Gene ENSMUSG00000049493
Gene Nameplastin 1 (I-isoform)
SynonymsI-fimbrin
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.263) question?
Stock #R7016 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location95752642-95845311 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 95786941 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 76 (F76I)
Ref Sequence ENSEMBL: ENSMUSP00000113200 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093800] [ENSMUST00000119760]
Predicted Effect probably damaging
Transcript: ENSMUST00000093800
AA Change: F76I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000091317
Gene: ENSMUSG00000049493
AA Change: F76I

DomainStartEndE-ValueType
EFh 15 43 8.5e-5 SMART
EFh 55 83 1.73e-5 SMART
low complexity region 100 116 N/A INTRINSIC
CH 124 236 3.69e-23 SMART
CH 268 375 4.4e-21 SMART
CH 398 503 7.27e-22 SMART
CH 519 624 3.75e-15 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000119760
AA Change: F76I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113200
Gene: ENSMUSG00000049493
AA Change: F76I

DomainStartEndE-ValueType
EFh 15 43 8.5e-5 SMART
EFh 55 83 1.73e-5 SMART
low complexity region 100 116 N/A INTRINSIC
PDB:1AOA|A 117 138 2e-6 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Plastins are a family of actin-binding proteins that are conserved throughout eukaryote evolution and expressed in most tissues of higher eukaryotes. In humans, two ubiquitous plastin isoforms (L and T) have been identified. The protein encoded by this gene is a third distinct plastin isoform, which is specifically expressed at high levels in the small intestine. Alternatively spliced transcript variants varying in the 5' UTR, but encoding the same protein, have been found for this gene. A pseudogene of this gene is found on chromosome 11.[provided by RefSeq, Feb 2010]
PHENOTYPE: Homozygous inactivation for this gene leads to altered intestinal morphology and physiology, increased brush border fragility and susceptibility to induced colitis, as well as a moderate and progressive form of hearing loss associated with defects in stereocilia morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810043G02Rik T A 10: 77,982,956 C154S probably benign Het
Abcb4 T A 5: 8,936,843 V754D probably benign Het
Actn1 T A 12: 80,172,968 M710L possibly damaging Het
Adam1a A G 5: 121,521,038 F64S probably benign Het
Aip G T 19: 4,121,402 D11E probably benign Het
Ak7 T A 12: 105,781,679 Y714* probably null Het
Amhr2 A G 15: 102,454,364 E522G possibly damaging Het
Amotl1 A G 9: 14,593,699 L108P probably damaging Het
Arhgef17 A G 7: 100,878,977 S677P probably benign Het
Atp11b T C 3: 35,841,036 S908P probably benign Het
Atp13a3 C A 16: 30,338,490 V903L possibly damaging Het
Bcam G A 7: 19,758,443 R576* probably null Het
Btbd2 A G 10: 80,648,615 S141P probably damaging Het
Cacna1b T C 2: 24,762,848 N67S possibly damaging Het
Cc2d2b A G 19: 40,795,804 T872A possibly damaging Het
Ccdc24 T A 4: 117,871,116 I144F probably null Het
Cep44 A T 8: 56,544,199 F101L possibly damaging Het
Disp1 C A 1: 183,087,466 R1130L probably damaging Het
Dnajc21 G T 15: 10,461,407 Y152* probably null Het
Edem2 A G 2: 155,716,072 F214L possibly damaging Het
Fam118b G A 9: 35,223,718 R198W probably damaging Het
Fam208b A T 13: 3,576,857 V1031E possibly damaging Het
Fgb A G 3: 83,046,064 V133A probably benign Het
Fsip2 A G 2: 82,990,635 T5571A probably benign Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,817 probably benign Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,266,277 probably benign Het
Hjurp TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTGCT TCT 1: 88,266,278 probably benign Het
Hnf4a T A 2: 163,564,273 Y277N probably damaging Het
Htatip2 A G 7: 49,770,835 D143G possibly damaging Het
Itgae A G 11: 73,119,516 N611D probably damaging Het
Ksr1 A T 11: 79,027,536 N515K probably damaging Het
Lrp1 C A 10: 127,559,967 probably null Het
Map3k20 T A 2: 72,378,635 V195D probably damaging Het
Meox2 A G 12: 37,109,224 S132G probably benign Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Nell2 T A 15: 95,229,151 N781I possibly damaging Het
Odf3l2 T C 10: 79,639,956 Y258C probably damaging Het
Olfr106-ps G A 17: 37,395,203 G221D possibly damaging Het
Olfr513 A G 7: 108,755,711 N285S probably damaging Het
Olfr535 A G 7: 140,493,240 T201A probably benign Het
Olfr631 A G 7: 103,929,530 I236V probably benign Het
Otoa A T 7: 121,147,766 Q918L probably damaging Het
Palld T G 8: 61,515,998 K1022T probably damaging Het
Parp8 A T 13: 116,895,091 S362T probably damaging Het
Phrf1 A G 7: 141,237,563 E95G probably damaging Het
Ptdss1 A C 13: 66,972,621 M294L probably benign Het
Rictor T A 15: 6,774,880 probably null Het
Rilp A G 11: 75,510,919 E175G probably damaging Het
Serpina16 T A 12: 103,675,371 T32S probably benign Het
Sim1 C T 10: 50,984,250 S736L probably benign Het
Smtn A G 11: 3,530,368 probably null Het
Sspo T A 6: 48,449,164 W98R probably damaging Het
St8sia3 A T 18: 64,269,583 I98F probably benign Het
Tbc1d4 T A 14: 101,487,441 N580I probably damaging Het
Trim12c A T 7: 104,348,206 C48S Het
Tsc22d1 C A 14: 76,417,542 T405K probably damaging Het
Tubgcp5 A G 7: 55,794,229 D2G possibly damaging Het
Wwc2 T C 8: 47,847,548 E960G unknown Het
Zbtb2 G C 10: 4,368,646 P460R probably damaging Het
Zfp62 T G 11: 49,215,937 I285S probably damaging Het
Other mutations in Pls1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Pls1 APN 9 95782419 missense possibly damaging 0.95
IGL00836:Pls1 APN 9 95761422 missense possibly damaging 0.86
IGL01391:Pls1 APN 9 95773698 missense probably benign 0.38
IGL02335:Pls1 APN 9 95784183 missense probably benign 0.32
IGL02875:Pls1 APN 9 95754351 missense possibly damaging 0.93
IGL03081:Pls1 APN 9 95773643 missense probably damaging 1.00
IGL03271:Pls1 APN 9 95776830 missense probably benign 0.04
PIT4585001:Pls1 UTSW 9 95761390 missense probably benign
R0048:Pls1 UTSW 9 95787063 missense probably damaging 1.00
R0088:Pls1 UTSW 9 95795768 missense possibly damaging 0.93
R0409:Pls1 UTSW 9 95786919 splice site probably benign
R2015:Pls1 UTSW 9 95761365 missense possibly damaging 0.77
R2516:Pls1 UTSW 9 95776563 missense probably benign 0.00
R2985:Pls1 UTSW 9 95785582 missense possibly damaging 0.73
R3964:Pls1 UTSW 9 95785612 missense probably benign 0.00
R3965:Pls1 UTSW 9 95785612 missense probably benign 0.00
R5240:Pls1 UTSW 9 95776622 splice site probably null
R5681:Pls1 UTSW 9 95787012 missense probably damaging 1.00
R6399:Pls1 UTSW 9 95754745 missense probably damaging 0.99
R6441:Pls1 UTSW 9 95754745 missense probably damaging 0.99
R6496:Pls1 UTSW 9 95754745 missense probably damaging 0.99
R6498:Pls1 UTSW 9 95754745 missense probably damaging 0.99
R6499:Pls1 UTSW 9 95754745 missense probably damaging 0.99
R7177:Pls1 UTSW 9 95773559 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTACAGTTATTCTAGGGCCTGAATG -3'
(R):5'- GCCTTGCCTTCATTTGACAG -3'

Sequencing Primer
(F):5'- AGGGCCTGAATGATTGTTATCTGAAC -3'
(R):5'- GCCTTCATTTGACAGTTTACCATG -3'
Posted On2019-05-13