Incidental Mutation 'R7016:Ak7'
ID545332
Institutional Source Beutler Lab
Gene Symbol Ak7
Ensembl Gene ENSMUSG00000041323
Gene Nameadenylate kinase 7
Synonyms4930502N02Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7016 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location105705976-105782447 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 105781679 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 714 (Y714*)
Ref Sequence ENSEMBL: ENSMUSP00000043145 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021535] [ENSMUST00000040876] [ENSMUST00000109901] [ENSMUST00000163473] [ENSMUST00000164326] [ENSMUST00000166329] [ENSMUST00000166735] [ENSMUST00000168186] [ENSMUST00000169938] [ENSMUST00000170002] [ENSMUST00000170540]
Predicted Effect probably benign
Transcript: ENSMUST00000021535
SMART Domains Protein: ENSMUSP00000021535
Gene: ENSMUSG00000021111

DomainStartEndE-ValueType
Pfam:PAP_central 17 365 1.5e-111 PFAM
Pfam:NTP_transf_2 75 175 2.4e-11 PFAM
Pfam:PAP_RNA-bind 366 508 8.9e-38 PFAM
low complexity region 518 534 N/A INTRINSIC
low complexity region 583 594 N/A INTRINSIC
low complexity region 605 622 N/A INTRINSIC
low complexity region 646 668 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000040876
AA Change: Y714*
SMART Domains Protein: ENSMUSP00000043145
Gene: ENSMUSG00000041323
AA Change: Y714*

DomainStartEndE-ValueType
low complexity region 46 57 N/A INTRINSIC
Pfam:ADK 431 675 1.4e-9 PFAM
Pfam:Dpy-30 679 720 3.2e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109901
SMART Domains Protein: ENSMUSP00000105527
Gene: ENSMUSG00000021111

DomainStartEndE-ValueType
low complexity region 4 17 N/A INTRINSIC
Pfam:PAP_central 21 364 4.1e-120 PFAM
Pfam:NTP_transf_2 82 175 8.1e-16 PFAM
Pfam:PAP_RNA-bind 366 435 4.1e-21 PFAM
low complexity region 518 534 N/A INTRINSIC
low complexity region 583 594 N/A INTRINSIC
low complexity region 605 622 N/A INTRINSIC
low complexity region 646 668 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163473
SMART Domains Protein: ENSMUSP00000131668
Gene: ENSMUSG00000021111

DomainStartEndE-ValueType
Pfam:PAP_central 17 365 9.2e-112 PFAM
Pfam:NTP_transf_2 75 175 3.3e-11 PFAM
Pfam:PAP_RNA-bind 366 508 4.6e-38 PFAM
low complexity region 518 534 N/A INTRINSIC
low complexity region 583 594 N/A INTRINSIC
low complexity region 605 622 N/A INTRINSIC
low complexity region 646 667 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164326
SMART Domains Protein: ENSMUSP00000125818
Gene: ENSMUSG00000021111

DomainStartEndE-ValueType
Pfam:PAP_central 17 64 9.1e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166329
SMART Domains Protein: ENSMUSP00000131725
Gene: ENSMUSG00000021111

DomainStartEndE-ValueType
Pfam:PAP_central 17 99 4.8e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166735
SMART Domains Protein: ENSMUSP00000128908
Gene: ENSMUSG00000021111

DomainStartEndE-ValueType
Pfam:PAP_central 17 283 9.4e-73 PFAM
Pfam:NTP_transf_2 72 175 5.7e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168186
SMART Domains Protein: ENSMUSP00000128402
Gene: ENSMUSG00000021111

DomainStartEndE-ValueType
Pfam:PAP_central 17 365 1.1e-111 PFAM
Pfam:NTP_transf_2 75 175 3.6e-11 PFAM
Pfam:PAP_RNA-bind 366 508 5e-38 PFAM
low complexity region 518 534 N/A INTRINSIC
low complexity region 583 594 N/A INTRINSIC
low complexity region 605 622 N/A INTRINSIC
low complexity region 646 668 N/A INTRINSIC
low complexity region 698 712 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169938
SMART Domains Protein: ENSMUSP00000130687
Gene: ENSMUSG00000021111

DomainStartEndE-ValueType
Pfam:PAP_central 17 157 4.5e-17 PFAM
Pfam:NTP_transf_2 74 166 2.3e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170002
SMART Domains Protein: ENSMUSP00000126275
Gene: ENSMUSG00000021111

DomainStartEndE-ValueType
Pfam:PAP_central 17 365 1e-111 PFAM
Pfam:NTP_transf_2 75 175 3.5e-11 PFAM
Pfam:PAP_RNA-bind 366 508 4.8e-38 PFAM
low complexity region 518 534 N/A INTRINSIC
low complexity region 583 594 N/A INTRINSIC
low complexity region 605 622 N/A INTRINSIC
low complexity region 646 663 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170540
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mice exhibit hydrocephalus, rhinitis, sperm defects and most die before 8 weeks of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810043G02Rik T A 10: 77,982,956 C154S probably benign Het
Abcb4 T A 5: 8,936,843 V754D probably benign Het
Actn1 T A 12: 80,172,968 M710L possibly damaging Het
Adam1a A G 5: 121,521,038 F64S probably benign Het
Aip G T 19: 4,121,402 D11E probably benign Het
Amhr2 A G 15: 102,454,364 E522G possibly damaging Het
Amotl1 A G 9: 14,593,699 L108P probably damaging Het
Arhgef17 A G 7: 100,878,977 S677P probably benign Het
Atp11b T C 3: 35,841,036 S908P probably benign Het
Atp13a3 C A 16: 30,338,490 V903L possibly damaging Het
Bcam G A 7: 19,758,443 R576* probably null Het
Btbd2 A G 10: 80,648,615 S141P probably damaging Het
Cacna1b T C 2: 24,762,848 N67S possibly damaging Het
Cc2d2b A G 19: 40,795,804 T872A possibly damaging Het
Ccdc24 T A 4: 117,871,116 I144F probably null Het
Cep44 A T 8: 56,544,199 F101L possibly damaging Het
Disp1 C A 1: 183,087,466 R1130L probably damaging Het
Dnajc21 G T 15: 10,461,407 Y152* probably null Het
Edem2 A G 2: 155,716,072 F214L possibly damaging Het
Fam118b G A 9: 35,223,718 R198W probably damaging Het
Fam208b A T 13: 3,576,857 V1031E possibly damaging Het
Fgb A G 3: 83,046,064 V133A probably benign Het
Fsip2 A G 2: 82,990,635 T5571A probably benign Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,817 probably benign Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,266,277 probably benign Het
Hjurp TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTGCT TCT 1: 88,266,278 probably benign Het
Hnf4a T A 2: 163,564,273 Y277N probably damaging Het
Htatip2 A G 7: 49,770,835 D143G possibly damaging Het
Itgae A G 11: 73,119,516 N611D probably damaging Het
Ksr1 A T 11: 79,027,536 N515K probably damaging Het
Lrp1 C A 10: 127,559,967 probably null Het
Map3k20 T A 2: 72,378,635 V195D probably damaging Het
Meox2 A G 12: 37,109,224 S132G probably benign Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Nell2 T A 15: 95,229,151 N781I possibly damaging Het
Odf3l2 T C 10: 79,639,956 Y258C probably damaging Het
Olfr106-ps G A 17: 37,395,203 G221D possibly damaging Het
Olfr513 A G 7: 108,755,711 N285S probably damaging Het
Olfr535 A G 7: 140,493,240 T201A probably benign Het
Olfr631 A G 7: 103,929,530 I236V probably benign Het
Otoa A T 7: 121,147,766 Q918L probably damaging Het
Palld T G 8: 61,515,998 K1022T probably damaging Het
Parp8 A T 13: 116,895,091 S362T probably damaging Het
Phrf1 A G 7: 141,237,563 E95G probably damaging Het
Pls1 A T 9: 95,786,941 F76I probably damaging Het
Ptdss1 A C 13: 66,972,621 M294L probably benign Het
Rictor T A 15: 6,774,880 probably null Het
Rilp A G 11: 75,510,919 E175G probably damaging Het
Serpina16 T A 12: 103,675,371 T32S probably benign Het
Sim1 C T 10: 50,984,250 S736L probably benign Het
Smtn A G 11: 3,530,368 probably null Het
Sspo T A 6: 48,449,164 W98R probably damaging Het
St8sia3 A T 18: 64,269,583 I98F probably benign Het
Tbc1d4 T A 14: 101,487,441 N580I probably damaging Het
Trim12c A T 7: 104,348,206 C48S Het
Tsc22d1 C A 14: 76,417,542 T405K probably damaging Het
Tubgcp5 A G 7: 55,794,229 D2G possibly damaging Het
Wwc2 T C 8: 47,847,548 E960G unknown Het
Zbtb2 G C 10: 4,368,646 P460R probably damaging Het
Zfp62 T G 11: 49,215,937 I285S probably damaging Het
Other mutations in Ak7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01100:Ak7 APN 12 105713574 missense probably benign 0.06
IGL01859:Ak7 APN 12 105745297 missense probably null
IGL01939:Ak7 APN 12 105734924 missense probably benign 0.06
IGL03233:Ak7 APN 12 105761480 missense probably damaging 1.00
drizzle UTSW 12 105742332 missense probably damaging 1.00
R0453:Ak7 UTSW 12 105716048 missense probably damaging 0.98
R0538:Ak7 UTSW 12 105766617 missense probably damaging 1.00
R0619:Ak7 UTSW 12 105733511 missense probably damaging 1.00
R0724:Ak7 UTSW 12 105710254 missense probably benign 0.00
R1028:Ak7 UTSW 12 105710189 small deletion probably benign
R1112:Ak7 UTSW 12 105713572 missense probably benign
R1449:Ak7 UTSW 12 105742261 missense possibly damaging 0.72
R1523:Ak7 UTSW 12 105766608 missense probably benign 0.18
R1626:Ak7 UTSW 12 105768548 missense probably benign 0.23
R1737:Ak7 UTSW 12 105742332 missense probably damaging 1.00
R1795:Ak7 UTSW 12 105726223 nonsense probably null
R1971:Ak7 UTSW 12 105726245 missense probably damaging 0.98
R2020:Ak7 UTSW 12 105745332 splice site probably null
R2267:Ak7 UTSW 12 105747214 missense probably benign
R3918:Ak7 UTSW 12 105710256 missense probably benign 0.03
R4600:Ak7 UTSW 12 105713575 missense probably benign 0.00
R4601:Ak7 UTSW 12 105713575 missense probably benign 0.00
R4602:Ak7 UTSW 12 105713575 missense probably benign 0.00
R4610:Ak7 UTSW 12 105713575 missense probably benign 0.00
R4611:Ak7 UTSW 12 105713575 missense probably benign 0.00
R4612:Ak7 UTSW 12 105761513 missense probably damaging 1.00
R4791:Ak7 UTSW 12 105710145 missense probably benign 0.05
R5523:Ak7 UTSW 12 105741082 nonsense probably null
R5911:Ak7 UTSW 12 105726212 missense probably damaging 1.00
R6066:Ak7 UTSW 12 105733491 missense possibly damaging 0.87
R6270:Ak7 UTSW 12 105768701 missense probably benign
R6767:Ak7 UTSW 12 105766607 missense probably damaging 0.98
R6960:Ak7 UTSW 12 105710244 missense probably benign
R7185:Ak7 UTSW 12 105742276 missense probably damaging 1.00
R7187:Ak7 UTSW 12 105745273 missense probably benign 0.00
R7204:Ak7 UTSW 12 105742243 missense probably benign
Predicted Primers PCR Primer
(F):5'- TATCAAAATGAAAAGGAAGCATGACT -3'
(R):5'- CAAGTGTGCCTCCTGTTTACT -3'

Sequencing Primer
(F):5'- GCATGACTGAAATATAACAGGGAAC -3'
(R):5'- TCCAAACATCCTTTCAATGAGATAGC -3'
Posted On2019-05-13