Incidental Mutation 'R7016:Parp8'
ID545335
Institutional Source Beutler Lab
Gene Symbol Parp8
Ensembl Gene ENSMUSG00000021725
Gene Namepoly (ADP-ribose) polymerase family, member 8
SynonymsD13Ertd275e, 2810430O08Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.146) question?
Stock #R7016 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location116854820-117025537 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 116895091 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 362 (S362T)
Ref Sequence ENSEMBL: ENSMUSP00000022239 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022239] [ENSMUST00000223949] [ENSMUST00000225344] [ENSMUST00000226107]
Predicted Effect probably damaging
Transcript: ENSMUST00000022239
AA Change: S362T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000022239
Gene: ENSMUSG00000021725
AA Change: S362T

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
low complexity region 22 34 N/A INTRINSIC
low complexity region 163 174 N/A INTRINSIC
low complexity region 217 228 N/A INTRINSIC
internal_repeat_1 332 410 4.61e-10 PROSPERO
internal_repeat_1 404 476 4.61e-10 PROSPERO
low complexity region 497 514 N/A INTRINSIC
Pfam:PARP 712 839 2e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000223949
AA Change: S323T

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000225344
Predicted Effect probably benign
Transcript: ENSMUST00000226107
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810043G02Rik T A 10: 77,982,956 C154S probably benign Het
Abcb4 T A 5: 8,936,843 V754D probably benign Het
Actn1 T A 12: 80,172,968 M710L possibly damaging Het
Adam1a A G 5: 121,521,038 F64S probably benign Het
Aip G T 19: 4,121,402 D11E probably benign Het
Ak7 T A 12: 105,781,679 Y714* probably null Het
Amhr2 A G 15: 102,454,364 E522G possibly damaging Het
Amotl1 A G 9: 14,593,699 L108P probably damaging Het
Arhgef17 A G 7: 100,878,977 S677P probably benign Het
Atp11b T C 3: 35,841,036 S908P probably benign Het
Atp13a3 C A 16: 30,338,490 V903L possibly damaging Het
Bcam G A 7: 19,758,443 R576* probably null Het
Btbd2 A G 10: 80,648,615 S141P probably damaging Het
Cacna1b T C 2: 24,762,848 N67S possibly damaging Het
Cc2d2b A G 19: 40,795,804 T872A possibly damaging Het
Ccdc24 T A 4: 117,871,116 I144F probably null Het
Cep44 A T 8: 56,544,199 F101L possibly damaging Het
Disp1 C A 1: 183,087,466 R1130L probably damaging Het
Dnajc21 G T 15: 10,461,407 Y152* probably null Het
Edem2 A G 2: 155,716,072 F214L possibly damaging Het
Fam118b G A 9: 35,223,718 R198W probably damaging Het
Fam208b A T 13: 3,576,857 V1031E possibly damaging Het
Fgb A G 3: 83,046,064 V133A probably benign Het
Fsip2 A G 2: 82,990,635 T5571A probably benign Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,817 probably benign Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,266,277 probably benign Het
Hjurp TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTGCT TCT 1: 88,266,278 probably benign Het
Hnf4a T A 2: 163,564,273 Y277N probably damaging Het
Htatip2 A G 7: 49,770,835 D143G possibly damaging Het
Itgae A G 11: 73,119,516 N611D probably damaging Het
Ksr1 A T 11: 79,027,536 N515K probably damaging Het
Lrp1 C A 10: 127,559,967 probably null Het
Map3k20 T A 2: 72,378,635 V195D probably damaging Het
Meox2 A G 12: 37,109,224 S132G probably benign Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Nell2 T A 15: 95,229,151 N781I possibly damaging Het
Odf3l2 T C 10: 79,639,956 Y258C probably damaging Het
Olfr106-ps G A 17: 37,395,203 G221D possibly damaging Het
Olfr513 A G 7: 108,755,711 N285S probably damaging Het
Olfr535 A G 7: 140,493,240 T201A probably benign Het
Olfr631 A G 7: 103,929,530 I236V probably benign Het
Otoa A T 7: 121,147,766 Q918L probably damaging Het
Palld T G 8: 61,515,998 K1022T probably damaging Het
Phrf1 A G 7: 141,237,563 E95G probably damaging Het
Pls1 A T 9: 95,786,941 F76I probably damaging Het
Ptdss1 A C 13: 66,972,621 M294L probably benign Het
Rictor T A 15: 6,774,880 probably null Het
Rilp A G 11: 75,510,919 E175G probably damaging Het
Serpina16 T A 12: 103,675,371 T32S probably benign Het
Sim1 C T 10: 50,984,250 S736L probably benign Het
Smtn A G 11: 3,530,368 probably null Het
Sspo T A 6: 48,449,164 W98R probably damaging Het
St8sia3 A T 18: 64,269,583 I98F probably benign Het
Tbc1d4 T A 14: 101,487,441 N580I probably damaging Het
Trim12c A T 7: 104,348,206 C48S Het
Tsc22d1 C A 14: 76,417,542 T405K probably damaging Het
Tubgcp5 A G 7: 55,794,229 D2G possibly damaging Het
Wwc2 T C 8: 47,847,548 E960G unknown Het
Zbtb2 G C 10: 4,368,646 P460R probably damaging Het
Zfp62 T G 11: 49,215,937 I285S probably damaging Het
Other mutations in Parp8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00916:Parp8 APN 13 116927323 missense probably damaging 1.00
IGL01346:Parp8 APN 13 116895064 missense possibly damaging 0.72
IGL01793:Parp8 APN 13 116910879 missense probably damaging 1.00
IGL01926:Parp8 APN 13 116862302 splice site probably benign
IGL01958:Parp8 APN 13 116876572 missense probably benign 0.14
IGL02131:Parp8 APN 13 116910873 missense probably benign 0.08
IGL02398:Parp8 APN 13 116910863 critical splice donor site probably null
IGL02496:Parp8 APN 13 116862302 splice site probably benign
IGL03135:Parp8 APN 13 116910942 missense probably benign 0.41
IGL03143:Parp8 APN 13 116910961 splice site probably benign
IGL03201:Parp8 APN 13 116863069 splice site probably benign
blondi UTSW 13 116893041 missense possibly damaging 0.77
Heidi UTSW 13 116862204 splice site probably null
R0362:Parp8 UTSW 13 116924968 nonsense probably null
R0699:Parp8 UTSW 13 116922584 missense probably benign 0.01
R1445:Parp8 UTSW 13 117025350 utr 5 prime probably null
R1676:Parp8 UTSW 13 116877528 missense probably damaging 0.99
R1977:Parp8 UTSW 13 116910913 missense probably damaging 0.96
R2019:Parp8 UTSW 13 116868432 splice site probably benign
R2049:Parp8 UTSW 13 116894886 missense probably benign 0.20
R2142:Parp8 UTSW 13 116894886 missense probably benign 0.20
R2474:Parp8 UTSW 13 116893041 missense possibly damaging 0.77
R2566:Parp8 UTSW 13 116895687 missense possibly damaging 0.78
R3863:Parp8 UTSW 13 116894767 missense probably benign 0.01
R4126:Parp8 UTSW 13 116868469 missense possibly damaging 0.94
R4518:Parp8 UTSW 13 116895673 missense possibly damaging 0.62
R4519:Parp8 UTSW 13 116895673 missense possibly damaging 0.62
R4767:Parp8 UTSW 13 116868536 missense probably damaging 0.99
R5355:Parp8 UTSW 13 116862204 splice site probably null
R5633:Parp8 UTSW 13 116876580 missense probably damaging 1.00
R5942:Parp8 UTSW 13 116869433 missense probably benign 0.12
R5978:Parp8 UTSW 13 116895732 missense probably benign 0.01
R6039:Parp8 UTSW 13 116877598 missense probably damaging 1.00
R6039:Parp8 UTSW 13 116877598 missense probably damaging 1.00
R6753:Parp8 UTSW 13 116895115 missense possibly damaging 0.91
R7139:Parp8 UTSW 13 117025266 missense probably benign 0.21
R7305:Parp8 UTSW 13 116894925 missense possibly damaging 0.95
R7314:Parp8 UTSW 13 116868460 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGTCTCCAGAACAAGATCGAGTC -3'
(R):5'- GGAGTGGCCAACATTTGTCC -3'

Sequencing Primer
(F):5'- CGAGTCAATAACTTATGGGACTTCAG -3'
(R):5'- GCCAACATTTGTCCGGTGG -3'
Posted On2019-05-13