Incidental Mutation 'R7016:Tsc22d1'
ID545336
Institutional Source Beutler Lab
Gene Symbol Tsc22d1
Ensembl Gene ENSMUSG00000022010
Gene NameTSC22 domain family, member 1
SynonymsTSC-22, Tgfb1i4, Egr5
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.309) question?
Stock #R7016 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location76414961-76507765 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 76417542 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 405 (T405K)
Ref Sequence ENSEMBL: ENSMUSP00000106513 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048371] [ENSMUST00000110888] [ENSMUST00000175984] [ENSMUST00000176581] [ENSMUST00000176886] [ENSMUST00000177471]
Predicted Effect probably damaging
Transcript: ENSMUST00000048371
AA Change: T487K

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000044517
Gene: ENSMUSG00000022010
AA Change: T487K

DomainStartEndE-ValueType
low complexity region 32 47 N/A INTRINSIC
low complexity region 59 96 N/A INTRINSIC
low complexity region 121 132 N/A INTRINSIC
low complexity region 191 208 N/A INTRINSIC
low complexity region 216 241 N/A INTRINSIC
low complexity region 246 257 N/A INTRINSIC
low complexity region 266 289 N/A INTRINSIC
low complexity region 461 489 N/A INTRINSIC
low complexity region 497 521 N/A INTRINSIC
low complexity region 537 556 N/A INTRINSIC
low complexity region 619 637 N/A INTRINSIC
low complexity region 673 687 N/A INTRINSIC
low complexity region 702 724 N/A INTRINSIC
low complexity region 933 970 N/A INTRINSIC
Pfam:TSC22 992 1048 7e-31 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110888
AA Change: T405K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106513
Gene: ENSMUSG00000022010
AA Change: T405K

DomainStartEndE-ValueType
low complexity region 32 47 N/A INTRINSIC
low complexity region 59 96 N/A INTRINSIC
low complexity region 121 132 N/A INTRINSIC
low complexity region 191 208 N/A INTRINSIC
low complexity region 216 241 N/A INTRINSIC
low complexity region 246 257 N/A INTRINSIC
low complexity region 266 289 N/A INTRINSIC
low complexity region 379 407 N/A INTRINSIC
low complexity region 415 439 N/A INTRINSIC
low complexity region 455 474 N/A INTRINSIC
internal_repeat_1 502 536 8.43e-5 PROSPERO
low complexity region 537 555 N/A INTRINSIC
low complexity region 591 605 N/A INTRINSIC
low complexity region 620 642 N/A INTRINSIC
internal_repeat_1 644 676 8.43e-5 PROSPERO
low complexity region 851 888 N/A INTRINSIC
Pfam:TSC22 910 969 4.7e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000175984
SMART Domains Protein: ENSMUSP00000135307
Gene: ENSMUSG00000022010

DomainStartEndE-ValueType
low complexity region 77 114 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176581
SMART Domains Protein: ENSMUSP00000135789
Gene: ENSMUSG00000022010

DomainStartEndE-ValueType
low complexity region 78 115 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176886
Predicted Effect probably benign
Transcript: ENSMUST00000177471
SMART Domains Protein: ENSMUSP00000134792
Gene: ENSMUSG00000022010

DomainStartEndE-ValueType
low complexity region 18 55 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the TSC22 domain family of leucine zipper transcription factors. The encoded protein is stimulated by transforming growth factor beta, and regulates the transcription of multiple genes including C-type natriuretic peptide. The encoded protein may play a critical role in tumor suppression through the induction of cancer cell apoptosis, and a single nucleotide polymorphism in the promoter of this gene has been associated with diabetic nephropathy. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mcie homozygous for a null allele exhibit increased proliferation of bone marrow cells and decreased kidney and heart weights. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810043G02Rik T A 10: 77,982,956 C154S probably benign Het
Abcb4 T A 5: 8,936,843 V754D probably benign Het
Actn1 T A 12: 80,172,968 M710L possibly damaging Het
Adam1a A G 5: 121,521,038 F64S probably benign Het
Aip G T 19: 4,121,402 D11E probably benign Het
Ak7 T A 12: 105,781,679 Y714* probably null Het
Amhr2 A G 15: 102,454,364 E522G possibly damaging Het
Amotl1 A G 9: 14,593,699 L108P probably damaging Het
Arhgef17 A G 7: 100,878,977 S677P probably benign Het
Asph T C 4: 9,630,604 probably null Het
Atp11b T C 3: 35,841,036 S908P probably benign Het
Atp13a3 C A 16: 30,338,490 V903L possibly damaging Het
Bcam G A 7: 19,758,443 R576* probably null Het
Btbd2 A G 10: 80,648,615 S141P probably damaging Het
Cacna1b T C 2: 24,762,848 N67S possibly damaging Het
Cc2d2b A G 19: 40,795,804 T872A possibly damaging Het
Ccdc24 T A 4: 117,871,116 I144F probably null Het
Cep44 A T 8: 56,544,199 F101L possibly damaging Het
Disp1 C A 1: 183,087,466 R1130L probably damaging Het
Dnajc21 G T 15: 10,461,407 Y152* probably null Het
Edem2 A G 2: 155,716,072 F214L possibly damaging Het
Fam118b G A 9: 35,223,718 R198W probably damaging Het
Fam208b A T 13: 3,576,857 V1031E possibly damaging Het
Fgb A G 3: 83,046,064 V133A probably benign Het
Fsip2 A G 2: 82,990,635 T5571A probably benign Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,817 probably benign Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,266,277 probably benign Het
Hjurp TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTGCT TCT 1: 88,266,278 probably benign Het
Hnf4a T A 2: 163,564,273 Y277N probably damaging Het
Htatip2 A G 7: 49,770,835 D143G possibly damaging Het
Itgae A G 11: 73,119,516 N611D probably damaging Het
Ksr1 A T 11: 79,027,536 N515K probably damaging Het
Lrp1 C A 10: 127,559,967 probably null Het
Map3k20 T A 2: 72,378,635 V195D probably damaging Het
Meox2 A G 12: 37,109,224 S132G probably benign Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Nell2 T A 15: 95,229,151 N781I possibly damaging Het
Odf3l2 T C 10: 79,639,956 Y258C probably damaging Het
Olfr106-ps G A 17: 37,395,203 G221D possibly damaging Het
Olfr513 A G 7: 108,755,711 N285S probably damaging Het
Olfr535 A G 7: 140,493,240 T201A probably benign Het
Olfr631 A G 7: 103,929,530 I236V probably benign Het
Otoa A T 7: 121,147,766 Q918L probably damaging Het
Palld T G 8: 61,515,998 K1022T probably damaging Het
Parp8 A T 13: 116,895,091 S362T probably damaging Het
Phrf1 A G 7: 141,237,563 E95G probably damaging Het
Pls1 A T 9: 95,786,941 F76I probably damaging Het
Pnp T A 14: 50,950,249 probably null Het
Ptdss1 A C 13: 66,972,621 M294L probably benign Het
Rictor T A 15: 6,774,880 probably null Het
Rilp A G 11: 75,510,919 E175G probably damaging Het
Serpina16 T A 12: 103,675,371 T32S probably benign Het
Sim1 C T 10: 50,984,250 S736L probably benign Het
Smarcc2 T G 10: 128,485,329 probably null Het
Smtn A G 11: 3,530,368 probably null Het
Sspo T A 6: 48,449,164 W98R probably damaging Het
St8sia3 A T 18: 64,269,583 I98F probably benign Het
Taf10 A T 7: 105,743,998 probably null Het
Tbc1d4 T A 14: 101,487,441 N580I probably damaging Het
Trim12c A T 7: 104,348,206 C48S Het
Tubgcp5 A G 7: 55,794,229 D2G possibly damaging Het
Wwc2 T C 8: 47,847,548 E960G unknown Het
Yme1l1 T A 2: 23,186,355 probably null Het
Zbtb2 G C 10: 4,368,646 P460R probably damaging Het
Zfp62 T G 11: 49,215,937 I285S probably damaging Het
Other mutations in Tsc22d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Tsc22d1 APN 14 76418917 missense probably damaging 0.99
IGL00515:Tsc22d1 APN 14 76418477 missense probably damaging 0.99
IGL00703:Tsc22d1 APN 14 76504828 missense possibly damaging 0.62
IGL00974:Tsc22d1 APN 14 76506442 missense probably damaging 1.00
IGL01015:Tsc22d1 APN 14 76418741 missense possibly damaging 0.66
IGL01515:Tsc22d1 APN 14 76505299 critical splice donor site probably null
IGL02172:Tsc22d1 APN 14 76417692 missense probably benign 0.04
IGL02307:Tsc22d1 APN 14 76416461 missense probably damaging 0.99
IGL02553:Tsc22d1 APN 14 76417398 missense possibly damaging 0.73
IGL02870:Tsc22d1 APN 14 76417617 missense probably benign 0.42
IGL02989:Tsc22d1 APN 14 76418901 missense probably benign 0.05
IGL03216:Tsc22d1 APN 14 76418637 missense probably benign 0.02
R0127:Tsc22d1 UTSW 14 76418981 missense possibly damaging 0.92
R0416:Tsc22d1 UTSW 14 76505303 splice site probably benign
R0854:Tsc22d1 UTSW 14 76418201 nonsense probably null
R0963:Tsc22d1 UTSW 14 76418599 missense possibly damaging 0.92
R1370:Tsc22d1 UTSW 14 76437664 intron probably benign
R1736:Tsc22d1 UTSW 14 76418357 missense probably benign 0.08
R1751:Tsc22d1 UTSW 14 76418102 missense probably damaging 0.98
R1760:Tsc22d1 UTSW 14 76416948 missense possibly damaging 0.69
R1767:Tsc22d1 UTSW 14 76418102 missense probably damaging 0.98
R2020:Tsc22d1 UTSW 14 76418333 missense probably damaging 1.00
R2209:Tsc22d1 UTSW 14 76418740 missense probably damaging 1.00
R2439:Tsc22d1 UTSW 14 76417267 unclassified probably benign
R2471:Tsc22d1 UTSW 14 76418204 missense probably benign 0.00
R3114:Tsc22d1 UTSW 14 76417337 missense probably damaging 1.00
R3907:Tsc22d1 UTSW 14 76416543 missense probably damaging 0.98
R3973:Tsc22d1 UTSW 14 76418609 missense probably damaging 1.00
R3974:Tsc22d1 UTSW 14 76418609 missense probably damaging 1.00
R3975:Tsc22d1 UTSW 14 76418609 missense probably damaging 1.00
R3976:Tsc22d1 UTSW 14 76418609 missense probably damaging 1.00
R4292:Tsc22d1 UTSW 14 76418880 missense probably benign 0.12
R4612:Tsc22d1 UTSW 14 76419005 missense possibly damaging 0.66
R4806:Tsc22d1 UTSW 14 76416988 splice site probably null
R4980:Tsc22d1 UTSW 14 76418256 missense probably benign 0.02
R5068:Tsc22d1 UTSW 14 76418310 missense probably benign 0.44
R5070:Tsc22d1 UTSW 14 76418310 missense probably benign 0.44
R5239:Tsc22d1 UTSW 14 76418412 missense probably damaging 0.99
R5360:Tsc22d1 UTSW 14 76417267 unclassified probably benign
R5400:Tsc22d1 UTSW 14 76417054 missense probably benign 0.00
R5616:Tsc22d1 UTSW 14 76416217 unclassified probably benign
R5726:Tsc22d1 UTSW 14 76505317 nonsense probably null
R5934:Tsc22d1 UTSW 14 76418826 missense possibly damaging 0.87
R6860:Tsc22d1 UTSW 14 76418292 missense possibly damaging 0.73
R6904:Tsc22d1 UTSW 14 76506483 nonsense probably null
R7274:Tsc22d1 UTSW 14 76416714 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AAAGGTCGATGGACTTGCAC -3'
(R):5'- TCAACTCTTGAGGCTGTAACTG -3'

Sequencing Primer
(F):5'- GTCGATGGACTTGCACAGAATTC -3'
(R):5'- AGGCTGTAACTGTACTTGTGACATC -3'
Posted On2019-05-13