Incidental Mutation 'R7016:Nell2'
ID545340
Institutional Source Beutler Lab
Gene Symbol Nell2
Ensembl Gene ENSMUSG00000022454
Gene NameNEL-like 2
SynonymsA330108N19Rik, mel91
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7016 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location95075230-95528559 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 95229151 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 781 (N781I)
Ref Sequence ENSEMBL: ENSMUSP00000155436 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075275] [ENSMUST00000166170] [ENSMUST00000229933] [ENSMUST00000229981]
Predicted Effect possibly damaging
Transcript: ENSMUST00000075275
AA Change: N781I

PolyPhen 2 Score 0.468 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000074751
Gene: ENSMUSG00000022454
AA Change: N781I

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
TSPN 32 217 9.94e-64 SMART
LamG 86 216 3.97e-8 SMART
coiled coil region 242 271 N/A INTRINSIC
VWC 277 333 6.18e-10 SMART
VWC 337 398 3.57e0 SMART
EGF 403 442 2.02e-1 SMART
EGF_CA 443 484 2.8e-9 SMART
EGF_CA 485 525 9.47e-7 SMART
EGF 527 556 1.28e-3 SMART
EGF_CA 558 604 2.13e-9 SMART
EGF_like 605 644 9.39e-4 SMART
VWC 643 695 8.88e-1 SMART
VWC 703 758 1.13e-17 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000166170
AA Change: N781I

PolyPhen 2 Score 0.468 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000131665
Gene: ENSMUSG00000022454
AA Change: N781I

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
TSPN 32 217 9.94e-64 SMART
LamG 86 216 3.97e-8 SMART
coiled coil region 242 271 N/A INTRINSIC
VWC 277 333 6.18e-10 SMART
VWC 337 398 3.57e0 SMART
EGF 403 442 2.02e-1 SMART
EGF_CA 443 484 2.8e-9 SMART
EGF_CA 485 525 9.47e-7 SMART
EGF 527 556 1.28e-3 SMART
EGF_CA 558 604 2.13e-9 SMART
EGF_like 605 644 9.39e-4 SMART
VWC 643 695 8.88e-1 SMART
VWC 703 758 1.13e-17 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000229933
AA Change: N781I

PolyPhen 2 Score 0.867 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000229981
AA Change: N781I

PolyPhen 2 Score 0.377 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a glycoprotein containing several von Willebrand factor C domains and epidermal growth factor (EGF)-like domains. The encoded protein acts as a homotrimer and is found in the cytoplasm. Several variants encoding a few different isoforms exist, and at least one isoform appears to be a secreted protein. Studies in mouse suggest that this protein plays a role in neural cell growth and differentiation as well as in oncogenesis. [provided by RefSeq, Feb 2009]
PHENOTYPE: Homozygous null mice display enhanced long term potentiation in the dentate gyrus of the hippocampus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810043G02Rik T A 10: 77,982,956 C154S probably benign Het
Abcb4 T A 5: 8,936,843 V754D probably benign Het
Actn1 T A 12: 80,172,968 M710L possibly damaging Het
Adam1a A G 5: 121,521,038 F64S probably benign Het
Aip G T 19: 4,121,402 D11E probably benign Het
Ak7 T A 12: 105,781,679 Y714* probably null Het
Amhr2 A G 15: 102,454,364 E522G possibly damaging Het
Amotl1 A G 9: 14,593,699 L108P probably damaging Het
Arhgef17 A G 7: 100,878,977 S677P probably benign Het
Asph T C 4: 9,630,604 probably null Het
Atp11b T C 3: 35,841,036 S908P probably benign Het
Atp13a3 C A 16: 30,338,490 V903L possibly damaging Het
Bcam G A 7: 19,758,443 R576* probably null Het
Btbd2 A G 10: 80,648,615 S141P probably damaging Het
Cacna1b T C 2: 24,762,848 N67S possibly damaging Het
Cc2d2b A G 19: 40,795,804 T872A possibly damaging Het
Ccdc24 T A 4: 117,871,116 I144F probably null Het
Cep44 A T 8: 56,544,199 F101L possibly damaging Het
Disp1 C A 1: 183,087,466 R1130L probably damaging Het
Dnajc21 G T 15: 10,461,407 Y152* probably null Het
Edem2 A G 2: 155,716,072 F214L possibly damaging Het
Fam118b G A 9: 35,223,718 R198W probably damaging Het
Fam208b A T 13: 3,576,857 V1031E possibly damaging Het
Fgb A G 3: 83,046,064 V133A probably benign Het
Fsip2 A G 2: 82,990,635 T5571A probably benign Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,817 probably benign Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,266,277 probably benign Het
Hjurp TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTGCT TCT 1: 88,266,278 probably benign Het
Hnf4a T A 2: 163,564,273 Y277N probably damaging Het
Htatip2 A G 7: 49,770,835 D143G possibly damaging Het
Itgae A G 11: 73,119,516 N611D probably damaging Het
Ksr1 A T 11: 79,027,536 N515K probably damaging Het
Lrp1 C A 10: 127,559,967 probably null Het
Map3k20 T A 2: 72,378,635 V195D probably damaging Het
Meox2 A G 12: 37,109,224 S132G probably benign Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Odf3l2 T C 10: 79,639,956 Y258C probably damaging Het
Olfr106-ps G A 17: 37,395,203 G221D possibly damaging Het
Olfr513 A G 7: 108,755,711 N285S probably damaging Het
Olfr535 A G 7: 140,493,240 T201A probably benign Het
Olfr631 A G 7: 103,929,530 I236V probably benign Het
Otoa A T 7: 121,147,766 Q918L probably damaging Het
Palld T G 8: 61,515,998 K1022T probably damaging Het
Parp8 A T 13: 116,895,091 S362T probably damaging Het
Phrf1 A G 7: 141,237,563 E95G probably damaging Het
Pls1 A T 9: 95,786,941 F76I probably damaging Het
Pnp T A 14: 50,950,249 probably null Het
Ptdss1 A C 13: 66,972,621 M294L probably benign Het
Rictor T A 15: 6,774,880 probably null Het
Rilp A G 11: 75,510,919 E175G probably damaging Het
Serpina16 T A 12: 103,675,371 T32S probably benign Het
Sim1 C T 10: 50,984,250 S736L probably benign Het
Smarcc2 T G 10: 128,485,329 probably null Het
Smtn A G 11: 3,530,368 probably null Het
Sspo T A 6: 48,449,164 W98R probably damaging Het
St8sia3 A T 18: 64,269,583 I98F probably benign Het
Taf10 A T 7: 105,743,998 probably null Het
Tbc1d4 T A 14: 101,487,441 N580I probably damaging Het
Trim12c A T 7: 104,348,206 C48S Het
Tsc22d1 C A 14: 76,417,542 T405K probably damaging Het
Tubgcp5 A G 7: 55,794,229 D2G possibly damaging Het
Wwc2 T C 8: 47,847,548 E960G unknown Het
Yme1l1 T A 2: 23,186,355 probably null Het
Zbtb2 G C 10: 4,368,646 P460R probably damaging Het
Zfp62 T G 11: 49,215,937 I285S probably damaging Het
Other mutations in Nell2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00559:Nell2 APN 15 95527285 missense possibly damaging 0.94
IGL00919:Nell2 APN 15 95383727 missense possibly damaging 0.88
IGL01124:Nell2 APN 15 95296179 missense probably damaging 1.00
IGL01356:Nell2 APN 15 95229183 missense probably damaging 0.99
IGL01865:Nell2 APN 15 95385081 missense possibly damaging 0.74
IGL02324:Nell2 APN 15 95229101 missense probably damaging 0.99
IGL02505:Nell2 APN 15 95296263 splice site probably benign
PIT4495001:Nell2 UTSW 15 95383727 missense probably benign 0.33
R0112:Nell2 UTSW 15 95431681 splice site probably benign
R0139:Nell2 UTSW 15 95432901 missense probably benign 0.13
R0355:Nell2 UTSW 15 95432901 missense probably benign 0.13
R0481:Nell2 UTSW 15 95432682 splice site probably null
R0535:Nell2 UTSW 15 95431607 missense probably benign 0.10
R0607:Nell2 UTSW 15 95229214 missense probably benign 0.06
R1378:Nell2 UTSW 15 95232521 missense probably damaging 1.00
R1688:Nell2 UTSW 15 95431613 missense probably damaging 0.97
R2054:Nell2 UTSW 15 95435109 missense probably benign 0.00
R2163:Nell2 UTSW 15 95429978 missense probably damaging 1.00
R2176:Nell2 UTSW 15 95435157 missense probably damaging 0.97
R3745:Nell2 UTSW 15 95432673 missense probably damaging 1.00
R5055:Nell2 UTSW 15 95473579 missense probably benign 0.00
R5184:Nell2 UTSW 15 95527809 missense possibly damaging 0.78
R5382:Nell2 UTSW 15 95229210 missense probably damaging 1.00
R6145:Nell2 UTSW 15 95473561 missense probably damaging 1.00
R6264:Nell2 UTSW 15 95346825 missense probably damaging 0.99
R6337:Nell2 UTSW 15 95385144 missense probably damaging 1.00
R6423:Nell2 UTSW 15 95527282 missense probably damaging 1.00
R6438:Nell2 UTSW 15 95232498 missense probably damaging 1.00
R6579:Nell2 UTSW 15 95385076 missense possibly damaging 0.88
R6810:Nell2 UTSW 15 95241587 missense probably damaging 1.00
R6894:Nell2 UTSW 15 95346887 missense probably damaging 1.00
R7266:Nell2 UTSW 15 95435393 missense possibly damaging 0.50
X0038:Nell2 UTSW 15 95527812 missense probably benign
Z1088:Nell2 UTSW 15 95435097 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAAGACCTATCTCCCGTTTCC -3'
(R):5'- TCCCTCACAGCAAGGAGAAG -3'

Sequencing Primer
(F):5'- ACCTCTGCTTACGGGACAC -3'
(R):5'- AGAAGTTGACTGTTGGCCCC -3'
Posted On2019-05-13