Incidental Mutation 'R7016:Amhr2'
ID545341
Institutional Source Beutler Lab
Gene Symbol Amhr2
Ensembl Gene ENSMUSG00000023047
Gene Nameanti-Mullerian hormone type 2 receptor
SynonymsMIS TypeII receptor, MISIIR
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.764) question?
Stock #R7016 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location102445367-102454633 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 102454364 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 522 (E522G)
Ref Sequence ENSEMBL: ENSMUSP00000023809 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023809] [ENSMUST00000023810] [ENSMUST00000164938] [ENSMUST00000164957] [ENSMUST00000171245] [ENSMUST00000229278]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023809
AA Change: E522G

PolyPhen 2 Score 0.633 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000023809
Gene: ENSMUSG00000023047
AA Change: E522G

DomainStartEndE-ValueType
Pfam:Activin_recp 46 124 3.4e-7 PFAM
transmembrane domain 146 168 N/A INTRINSIC
low complexity region 177 188 N/A INTRINSIC
Pfam:Pkinase 199 501 4.6e-25 PFAM
Pfam:Pkinase_Tyr 199 501 2.6e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000023810
SMART Domains Protein: ENSMUSP00000023810
Gene: ENSMUSG00000023048

DomainStartEndE-ValueType
low complexity region 22 48 N/A INTRINSIC
low complexity region 50 85 N/A INTRINSIC
low complexity region 102 136 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000123735
Gene: ENSMUSG00000023047
AA Change: E143G

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 3 73 2.4e-8 PFAM
Pfam:Pkinase 6 84 1e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164938
SMART Domains Protein: ENSMUSP00000129218
Gene: ENSMUSG00000023048

DomainStartEndE-ValueType
low complexity region 22 48 N/A INTRINSIC
low complexity region 50 79 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164957
SMART Domains Protein: ENSMUSP00000125784
Gene: ENSMUSG00000023048

DomainStartEndE-ValueType
low complexity region 22 48 N/A INTRINSIC
low complexity region 50 85 N/A INTRINSIC
low complexity region 102 136 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171245
SMART Domains Protein: ENSMUSP00000132636
Gene: ENSMUSG00000023048

DomainStartEndE-ValueType
low complexity region 22 48 N/A INTRINSIC
low complexity region 50 85 N/A INTRINSIC
low complexity region 102 136 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000229278
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the receptor for the anti-Mullerian hormone (AMH) which, in addition to testosterone, results in male sex differentiation. AMH and testosterone are produced in the testes by different cells and have different effects. Testosterone promotes the development of male genitalia while the binding of AMH to the encoded receptor prevents the development of the mullerian ducts into uterus and Fallopian tubes. Mutations in this gene are associated with persistent Mullerian duct syndrome type II. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous null mutant males have a complete male reproductive tract, but also a uterus and oviducts. Functional sperm are produced, but most males are infertile because female reproductive organs block sperm transfer. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810043G02Rik T A 10: 77,982,956 C154S probably benign Het
Abcb4 T A 5: 8,936,843 V754D probably benign Het
Actn1 T A 12: 80,172,968 M710L possibly damaging Het
Adam1a A G 5: 121,521,038 F64S probably benign Het
Aip G T 19: 4,121,402 D11E probably benign Het
Ak7 T A 12: 105,781,679 Y714* probably null Het
Amotl1 A G 9: 14,593,699 L108P probably damaging Het
Arhgef17 A G 7: 100,878,977 S677P probably benign Het
Asph T C 4: 9,630,604 probably null Het
Atp11b T C 3: 35,841,036 S908P probably benign Het
Atp13a3 C A 16: 30,338,490 V903L possibly damaging Het
Bcam G A 7: 19,758,443 R576* probably null Het
Btbd2 A G 10: 80,648,615 S141P probably damaging Het
Cacna1b T C 2: 24,762,848 N67S possibly damaging Het
Cc2d2b A G 19: 40,795,804 T872A possibly damaging Het
Ccdc24 T A 4: 117,871,116 I144F probably null Het
Cep44 A T 8: 56,544,199 F101L possibly damaging Het
Disp1 C A 1: 183,087,466 R1130L probably damaging Het
Dnajc21 G T 15: 10,461,407 Y152* probably null Het
Edem2 A G 2: 155,716,072 F214L possibly damaging Het
Fam118b G A 9: 35,223,718 R198W probably damaging Het
Fam208b A T 13: 3,576,857 V1031E possibly damaging Het
Fgb A G 3: 83,046,064 V133A probably benign Het
Fsip2 A G 2: 82,990,635 T5571A probably benign Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,817 probably benign Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,266,277 probably benign Het
Hjurp TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTGCT TCT 1: 88,266,278 probably benign Het
Hnf4a T A 2: 163,564,273 Y277N probably damaging Het
Htatip2 A G 7: 49,770,835 D143G possibly damaging Het
Itgae A G 11: 73,119,516 N611D probably damaging Het
Ksr1 A T 11: 79,027,536 N515K probably damaging Het
Lrp1 C A 10: 127,559,967 probably null Het
Map3k20 T A 2: 72,378,635 V195D probably damaging Het
Meox2 A G 12: 37,109,224 S132G probably benign Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Nell2 T A 15: 95,229,151 N781I possibly damaging Het
Odf3l2 T C 10: 79,639,956 Y258C probably damaging Het
Olfr106-ps G A 17: 37,395,203 G221D possibly damaging Het
Olfr513 A G 7: 108,755,711 N285S probably damaging Het
Olfr535 A G 7: 140,493,240 T201A probably benign Het
Olfr631 A G 7: 103,929,530 I236V probably benign Het
Otoa A T 7: 121,147,766 Q918L probably damaging Het
Palld T G 8: 61,515,998 K1022T probably damaging Het
Parp8 A T 13: 116,895,091 S362T probably damaging Het
Phrf1 A G 7: 141,237,563 E95G probably damaging Het
Pls1 A T 9: 95,786,941 F76I probably damaging Het
Pnp T A 14: 50,950,249 probably null Het
Ptdss1 A C 13: 66,972,621 M294L probably benign Het
Rictor T A 15: 6,774,880 probably null Het
Rilp A G 11: 75,510,919 E175G probably damaging Het
Serpina16 T A 12: 103,675,371 T32S probably benign Het
Sim1 C T 10: 50,984,250 S736L probably benign Het
Smarcc2 T G 10: 128,485,329 probably null Het
Smtn A G 11: 3,530,368 probably null Het
Sspo T A 6: 48,449,164 W98R probably damaging Het
St8sia3 A T 18: 64,269,583 I98F probably benign Het
Taf10 A T 7: 105,743,998 probably null Het
Tbc1d4 T A 14: 101,487,441 N580I probably damaging Het
Trim12c A T 7: 104,348,206 C48S Het
Tsc22d1 C A 14: 76,417,542 T405K probably damaging Het
Tubgcp5 A G 7: 55,794,229 D2G possibly damaging Het
Wwc2 T C 8: 47,847,548 E960G unknown Het
Yme1l1 T A 2: 23,186,355 probably null Het
Zbtb2 G C 10: 4,368,646 P460R probably damaging Het
Zfp62 T G 11: 49,215,937 I285S probably damaging Het
Other mutations in Amhr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02273:Amhr2 APN 15 102452489 missense probably benign 0.02
IGL02941:Amhr2 APN 15 102447289 missense probably damaging 1.00
R0269:Amhr2 UTSW 15 102447068 missense probably benign 0.39
R0645:Amhr2 UTSW 15 102446428 missense probably damaging 1.00
R1128:Amhr2 UTSW 15 102452821 missense probably benign 0.10
R1857:Amhr2 UTSW 15 102446777 nonsense probably null
R3500:Amhr2 UTSW 15 102447066 missense probably benign 0.01
R3882:Amhr2 UTSW 15 102445898 missense probably damaging 1.00
R4661:Amhr2 UTSW 15 102454253 missense probably damaging 1.00
R4980:Amhr2 UTSW 15 102454330 missense probably benign 0.00
R5053:Amhr2 UTSW 15 102447258 missense probably damaging 1.00
R7003:Amhr2 UTSW 15 102446333 missense probably benign 0.00
R7293:Amhr2 UTSW 15 102447393 missense probably benign 0.00
X0013:Amhr2 UTSW 15 102452752 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGGAGATGTCTGCTCTGG -3'
(R):5'- TGACAGCAGTAGGCATGTCG -3'

Sequencing Primer
(F):5'- GCCAGGCCTGCCATCTTC -3'
(R):5'- ATGTCGGCCACACGCATG -3'
Posted On2019-05-13