Incidental Mutation 'R7017:Tgm1'
ID545405
Institutional Source Beutler Lab
Gene Symbol Tgm1
Ensembl Gene ENSMUSG00000022218
Gene Nametransglutaminase 1, K polypeptide
SynonymsTG K, TGase 1, protein-glutamine-gamma-glutamyltransferase, K polypeptide, 2310004J08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.908) question?
Stock #R7017 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location55700009-55713926 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 55704941 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 651 (Y651F)
Ref Sequence ENSEMBL: ENSMUSP00000137642 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002389] [ENSMUST00000168729] [ENSMUST00000178034]
Predicted Effect possibly damaging
Transcript: ENSMUST00000002389
AA Change: Y651F

PolyPhen 2 Score 0.757 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000002389
Gene: ENSMUSG00000022218
AA Change: Y651F

DomainStartEndE-ValueType
low complexity region 13 45 N/A INTRINSIC
low complexity region 50 63 N/A INTRINSIC
low complexity region 65 95 N/A INTRINSIC
Pfam:Transglut_N 109 228 5.5e-35 PFAM
TGc 368 461 1.7e-43 SMART
low complexity region 550 561 N/A INTRINSIC
Pfam:Transglut_C 578 682 1.5e-22 PFAM
Pfam:Transglut_C 690 787 1e-20 PFAM
low complexity region 788 804 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000168729
AA Change: Y651F

PolyPhen 2 Score 0.757 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000128090
Gene: ENSMUSG00000022218
AA Change: Y651F

DomainStartEndE-ValueType
low complexity region 13 45 N/A INTRINSIC
low complexity region 50 63 N/A INTRINSIC
low complexity region 65 95 N/A INTRINSIC
Pfam:Transglut_N 109 228 5.5e-35 PFAM
TGc 368 461 1.7e-43 SMART
low complexity region 550 561 N/A INTRINSIC
Pfam:Transglut_C 578 682 1.5e-22 PFAM
Pfam:Transglut_C 690 787 1e-20 PFAM
low complexity region 788 804 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000178034
AA Change: Y651F

PolyPhen 2 Score 0.757 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000137642
Gene: ENSMUSG00000022218
AA Change: Y651F

DomainStartEndE-ValueType
low complexity region 13 45 N/A INTRINSIC
low complexity region 50 63 N/A INTRINSIC
low complexity region 65 95 N/A INTRINSIC
Pfam:Transglut_N 110 226 1.2e-32 PFAM
TGc 368 461 1.7e-43 SMART
low complexity region 550 561 N/A INTRINSIC
Pfam:Transglut_C 578 682 3.6e-24 PFAM
Pfam:Transglut_C 690 787 1.3e-20 PFAM
low complexity region 788 804 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane protein that catalyzes the addition of an alkyl group from an akylamine to a glutamine residue of a protein, forming an alkylglutamine in the protein. This protein alkylation leads to crosslinking of proteins and catenation of polyamines to proteins. This gene contains either one or two copies of a 22 nt repeat unit in its 3' UTR. Mutations in this gene have been associated with autosomal recessive lamellar ichthyosis (LI) and nonbullous congenital ichthyosiform erythroderma (NCIE). [provided by RefSeq, Jul 2008]
PHENOTYPE: Newborn mice homozygous for a knock-out allele are small and hypoactive and die within hours of birth displaying failure to suckle, progressive dehydration, and epidermal defects including a reddish, tight and wrinkled skin, hyperkeratosis, and impaired skin barrier function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410137M14Rik A G 17: 36,978,034 probably benign Het
Acot3 A T 12: 84,053,303 probably benign Het
Add3 T A 19: 53,233,853 V297E possibly damaging Het
Arfgap1 C G 2: 180,976,304 probably null Het
C530008M17Rik GAGGCAGCGCGAGGCCGAGAGGCAGGAGGAGGAAGCAAGACAACGCGAGGCCGAGAGGCAGG GAGACAACGCGAGGCCGAGAGGCAGG 5: 76,856,948 probably benign Het
Cacna1i T C 15: 80,380,470 F1500L probably damaging Het
Cacna1s T C 1: 136,095,858 I945T probably damaging Het
Ccdc180 T A 4: 45,940,934 N1334K possibly damaging Het
Cd5l C A 3: 87,366,061 Y112* probably null Het
Cyp2d40 A T 15: 82,760,033 F297Y unknown Het
Ddx4 C T 13: 112,601,488 V546I probably damaging Het
Dgkg T C 16: 22,572,713 M332V probably benign Het
Dnah12 T C 14: 26,735,680 I867T probably benign Het
Dnah2 T A 11: 69,491,547 K1246* probably null Het
Drd2 G A 9: 49,400,829 V161I probably benign Het
Dsp A G 13: 38,186,707 D862G probably benign Het
Ephx4 T C 5: 107,406,114 F10S probably damaging Het
Fabp9 C A 3: 10,194,696 A76S possibly damaging Het
Fam198a T C 9: 121,965,986 probably null Het
Fam46b T C 4: 133,486,234 S139P possibly damaging Het
Fat4 G A 3: 38,891,543 M1528I probably benign Het
Fbxl12 A G 9: 20,618,320 S84P unknown Het
Fbxo40 T C 16: 36,970,370 D126G probably damaging Het
Fpr1 C T 17: 17,877,392 V112I probably benign Het
Frem2 T C 3: 53,519,602 N2975S probably benign Het
Gm7945 T C 14: 41,383,653 Y156C Het
Gnpat T C 8: 124,863,275 V13A probably benign Het
Gpx5 G A 13: 21,291,391 P55L probably damaging Het
Hbp1 A G 12: 31,943,853 S59P probably damaging Het
Ighv1-36 T A 12: 114,879,913 D109V probably damaging Het
Iqcf5 T A 9: 106,515,664 I40N possibly damaging Het
Kcnma1 T G 14: 23,494,643 I484L possibly damaging Het
Kera A T 10: 97,609,077 R99S possibly damaging Het
Kif3b T A 2: 153,329,724 S707R possibly damaging Het
Lilra6 G T 7: 3,908,708 T317N possibly damaging Het
Lrrc15 C T 16: 30,272,962 E520K probably benign Het
Lrrc34 C T 3: 30,645,316 probably null Het
Lvrn A G 18: 46,850,678 T163A probably benign Het
Met T A 6: 17,491,287 L16* probably null Het
Mpzl2 G T 9: 45,047,289 D108Y probably benign Het
Mrgprb2 T A 7: 48,552,837 I47F probably benign Het
Muc5ac G C 7: 141,809,687 probably benign Het
Mybphl T A 3: 108,374,838 V128E probably damaging Het
Nckap5 A T 1: 126,102,661 D231E probably damaging Het
Olfr1000 T A 2: 85,608,329 M194L probably benign Het
Orm1 T A 4: 63,345,211 I87K probably benign Het
Pdgfrb C T 18: 61,081,004 P954S probably benign Het
Pdzd8 G T 19: 59,345,352 S79* probably null Het
Pdzd9 T A 7: 120,663,002 H79L probably benign Het
Plcg1 A T 2: 160,758,097 I926F probably damaging Het
Plec A T 15: 76,173,541 F4078L probably damaging Het
Plek G A 11: 17,052,220 probably benign Het
Pogz T C 3: 94,854,024 I25T probably damaging Het
Ppfia3 A T 7: 45,358,800 D215E probably benign Het
Psg22 C A 7: 18,724,441 S352R probably benign Het
Ptchd4 A G 17: 42,502,735 Y509C probably damaging Het
Ralgapb C A 2: 158,448,337 N389K probably benign Het
Rdh1 A G 10: 127,763,037 D129G probably benign Het
Rimbp3 A G 16: 17,209,746 T345A probably benign Het
S100a14 T C 3: 90,527,295 probably null Het
Scamp1 T A 13: 94,224,915 R152S probably damaging Het
Slc30a2 G A 4: 134,347,415 R161Q probably damaging Het
Srf T C 17: 46,550,904 T383A probably benign Het
St6galnac5 T C 3: 152,846,403 M176V probably damaging Het
St8sia1 C A 6: 142,867,906 V177F probably damaging Het
Syt12 C T 19: 4,460,867 probably null Het
Tanc2 A G 11: 105,923,108 I1793V probably benign Het
Tas2r123 A G 6: 132,847,550 I137V probably benign Het
Tenm2 T A 11: 36,171,409 Y543F probably damaging Het
Tgfbr1 T C 4: 47,410,728 I488T probably damaging Het
Thbs3 A T 3: 89,224,415 D698V probably damaging Het
Tpra1 T A 6: 88,908,312 I82N probably damaging Het
Ubr4 T A 4: 139,393,090 D275E probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Wwp1 T C 4: 19,623,124 Y787C probably damaging Het
Znfx1 T C 2: 167,048,534 S677G probably damaging Het
Other mutations in Tgm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02206:Tgm1 APN 14 55704935 missense possibly damaging 0.92
IGL02934:Tgm1 APN 14 55709989 missense probably damaging 1.00
IGL03243:Tgm1 APN 14 55705907 missense probably damaging 0.98
IGL03282:Tgm1 APN 14 55711070 missense probably damaging 1.00
PIT4458001:Tgm1 UTSW 14 55712565 missense unknown
R0277:Tgm1 UTSW 14 55710927 unclassified probably benign
R0277:Tgm1 UTSW 14 55712652 unclassified probably benign
R0478:Tgm1 UTSW 14 55700334 nonsense probably null
R1349:Tgm1 UTSW 14 55711201 unclassified probably benign
R1594:Tgm1 UTSW 14 55709519 missense probably damaging 0.96
R1776:Tgm1 UTSW 14 55709397 missense probably damaging 0.99
R1852:Tgm1 UTSW 14 55704941 missense probably damaging 1.00
R1988:Tgm1 UTSW 14 55705577 missense probably benign 0.00
R2064:Tgm1 UTSW 14 55709471 missense probably damaging 1.00
R2139:Tgm1 UTSW 14 55709543 missense probably damaging 1.00
R2427:Tgm1 UTSW 14 55712100 critical splice donor site probably null
R3710:Tgm1 UTSW 14 55712595 unclassified probably benign
R3917:Tgm1 UTSW 14 55712757 splice site probably benign
R4697:Tgm1 UTSW 14 55705681 missense probably benign 0.05
R4804:Tgm1 UTSW 14 55705619 missense probably benign 0.38
R5074:Tgm1 UTSW 14 55709935 missense probably damaging 1.00
R5341:Tgm1 UTSW 14 55700248 missense possibly damaging 0.90
R5346:Tgm1 UTSW 14 55711172 missense probably damaging 0.99
R5557:Tgm1 UTSW 14 55705643 missense probably benign 0.10
R5566:Tgm1 UTSW 14 55712436 missense probably damaging 0.99
R5828:Tgm1 UTSW 14 55705554 missense probably benign 0.38
R6802:Tgm1 UTSW 14 55712482 unclassified probably benign
R7094:Tgm1 UTSW 14 55704843 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- CTTGTCTCAGGCTTAGCGTG -3'
(R):5'- AGATGGTACTCCCTCTCCTG -3'

Sequencing Primer
(F):5'- GCCTCAAGCTCTGGGTCTC -3'
(R):5'- GCCCTGCCTCTGGGTATC -3'
Posted On2019-05-13