Incidental Mutation 'R7019:Olfr251'
ID545512
Institutional Source Beutler Lab
Gene Symbol Olfr251
Ensembl Gene ENSMUSG00000096757
Gene Nameolfactory receptor 251
SynonymsMOR170-15, GA_x6K02T2MYUG-9124-8183
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R7019 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location38377086-38382474 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 38378802 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 307 (L307Q)
Ref Sequence ENSEMBL: ENSMUSP00000072514 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072731] [ENSMUST00000214865]
Predicted Effect possibly damaging
Transcript: ENSMUST00000072731
AA Change: L307Q

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000072514
Gene: ENSMUSG00000096757
AA Change: L307Q

DomainStartEndE-ValueType
Pfam:7tm_4 37 313 9.8e-50 PFAM
Pfam:7tm_1 47 296 4.2e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000214865
AA Change: L301Q

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abat A T 16: 8,618,531 K414* probably null Het
Aco1 T A 4: 40,186,376 I596N probably damaging Het
Adgre1 A C 17: 57,410,945 D319A probably damaging Het
BC067074 C T 13: 113,351,750 T102I probably benign Het
Birc6 T C 17: 74,609,345 V445A probably benign Het
Btd A C 14: 31,667,105 Q261P probably damaging Het
Btd G T 14: 31,667,106 Q261H possibly damaging Het
C7 T A 15: 5,045,682 Y176F probably benign Het
Ccdc102a T C 8: 94,909,803 S287G probably benign Het
Ccdc178 T A 18: 22,150,438 T12S probably benign Het
Cnga4 G T 7: 105,405,829 A104S probably benign Het
Col10a1 G T 10: 34,394,951 L306F probably damaging Het
Cpne5 T C 17: 29,226,222 D36G probably damaging Het
Csmd2 G A 4: 128,369,063 D681N Het
Cstl1 A G 2: 148,755,303 M75V probably benign Het
Cyp26a1 T C 19: 37,698,812 L149P probably damaging Het
D630045J12Rik T G 6: 38,194,635 E866A probably benign Het
Dlec1 C T 9: 119,112,422 P292L probably benign Het
Dpp3 T G 19: 4,916,789 E402A possibly damaging Het
Epha5 T C 5: 84,416,462 Q15R possibly damaging Het
Esyt3 A G 9: 99,315,285 F831L probably benign Het
Fam50b G A 13: 34,747,101 E187K possibly damaging Het
Fut7 A G 2: 25,425,780 D350G probably benign Het
Gab1 C A 8: 80,784,817 E466D probably damaging Het
Glrp1 A T 1: 88,503,168 M160K unknown Het
Gngt1 T C 6: 3,994,088 probably null Het
Gprc6a A T 10: 51,631,412 V7E possibly damaging Het
Idh3b A T 2: 130,280,966 V301D probably damaging Het
Ifi202b A C 1: 173,963,958 C385G probably benign Het
Ilvbl T A 10: 78,579,086 L261Q probably damaging Het
Irx6 T A 8: 92,678,734 L410Q probably damaging Het
Ism2 T C 12: 87,299,663 M15V unknown Het
Itih5 C A 2: 10,190,327 R177S probably damaging Het
Klra3 C T 6: 130,327,124 G202R probably damaging Het
Krt7 T C 15: 101,413,970 V103A probably damaging Het
Lama3 T C 18: 12,528,418 S2145P probably damaging Het
Mlph A G 1: 90,941,706 R477G probably damaging Het
Mybpc1 T A 10: 88,543,719 L653F probably damaging Het
Myrfl A G 10: 116,781,947 probably null Het
Myrip T G 9: 120,422,507 L232R probably damaging Het
Nrd1 A T 4: 109,028,802 H126L probably benign Het
Olfr469 G T 7: 107,823,158 L104I probably benign Het
Olfr722 A T 14: 49,895,667 I45N probably damaging Het
Pcdhb10 T A 18: 37,413,003 N377K probably damaging Het
Pigt CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT 2: 164,499,669 probably null Het
Prkdc A C 16: 15,769,966 I2572L probably benign Het
Ptpro C A 6: 137,380,478 D322E probably benign Het
R3hcc1 A G 14: 69,704,125 I332T probably damaging Het
Rab8a T C 8: 72,161,383 F9L probably damaging Het
Ranbp3l A T 15: 9,057,160 K165N probably damaging Het
Rock2 T A 12: 16,977,740 C1353S probably damaging Het
Rsad2 T A 12: 26,456,419 M1L possibly damaging Het
Vmn1r104 A G 7: 20,534,566 M244V probably benign Het
Vmn1r232 G A 17: 20,913,285 T351M possibly damaging Het
Vmn2r50 A G 7: 10,050,245 Y101H probably benign Het
Vmn2r57 A G 7: 41,428,665 L123P probably damaging Het
Wdr17 T C 8: 54,681,453 N331D probably damaging Het
Wdr47 C T 3: 108,614,355 Q89* probably null Het
Zcchc4 A T 5: 52,784,033 T57S probably benign Het
Other mutations in Olfr251
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02013:Olfr251 APN 9 38378077 missense probably benign 0.31
IGL02131:Olfr251 APN 9 38377907 missense probably benign 0.01
IGL02311:Olfr251 APN 9 38377898 nonsense probably null
IGL02377:Olfr251 APN 9 38378246 missense probably damaging 1.00
R0284:Olfr251 UTSW 9 38378584 missense probably benign 0.00
R0412:Olfr251 UTSW 9 38378794 missense probably damaging 0.98
R0903:Olfr251 UTSW 9 38378801 missense probably benign 0.00
R1664:Olfr251 UTSW 9 38378252 missense possibly damaging 0.93
R2902:Olfr251 UTSW 9 38378041 missense possibly damaging 0.89
R3970:Olfr251 UTSW 9 38377926 missense probably damaging 0.98
R4191:Olfr251 UTSW 9 38378352 missense probably damaging 0.98
R4650:Olfr251 UTSW 9 38378403 missense probably damaging 1.00
R4910:Olfr251 UTSW 9 38378742 missense probably null 0.98
R5256:Olfr251 UTSW 9 38377917 missense probably benign 0.00
R5385:Olfr251 UTSW 9 38377985 missense probably benign
R5386:Olfr251 UTSW 9 38377985 missense probably benign
R6005:Olfr251 UTSW 9 38378309 missense probably damaging 1.00
R6268:Olfr251 UTSW 9 38378088 missense probably benign 0.10
R6486:Olfr251 UTSW 9 38377904 missense probably benign
R7045:Olfr251 UTSW 9 38378433 missense probably damaging 0.99
R7120:Olfr251 UTSW 9 38378649 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTCCCACATCATAACTGTTAGC -3'
(R):5'- GGCAGTGATCAACATTCTGGAG -3'

Sequencing Primer
(F):5'- CATAACTGTTAGCCTCTTTTATGGG -3'
(R):5'- GTGATCAACATTCTGGAGCAATATG -3'
Posted On2019-05-13