Incidental Mutation 'R7020:Wdr19'
ID545563
Institutional Source Beutler Lab
Gene Symbol Wdr19
Ensembl Gene ENSMUSG00000037890
Gene NameWD repeat domain 19
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7020 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location65199696-65260415 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 65256314 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1200 (E1200G)
Ref Sequence ENSEMBL: ENSMUSP00000144866 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041892] [ENSMUST00000203653]
Predicted Effect probably damaging
Transcript: ENSMUST00000041892
AA Change: E1200G

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000038098
Gene: ENSMUSG00000037890
AA Change: E1200G

DomainStartEndE-ValueType
WD40 6 42 4.26e1 SMART
WD40 44 83 2.13e1 SMART
WD40 85 125 2.75e1 SMART
WD40 128 166 2.67e-1 SMART
Blast:WD40 220 258 6e-9 BLAST
WD40 264 302 1.46e-1 SMART
Blast:WD40 308 347 2e-18 BLAST
Pfam:WD40_3 508 564 2.7e-32 PFAM
low complexity region 1103 1116 N/A INTRINSIC
low complexity region 1259 1268 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203554
Predicted Effect probably damaging
Transcript: ENSMUST00000203653
AA Change: E1200G

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000144866
Gene: ENSMUSG00000037890
AA Change: E1200G

DomainStartEndE-ValueType
WD40 6 42 4.26e1 SMART
WD40 44 83 2.13e1 SMART
WD40 85 125 2.75e1 SMART
WD40 128 166 2.67e-1 SMART
Blast:WD40 220 258 6e-9 BLAST
WD40 264 302 1.46e-1 SMART
Blast:WD40 308 347 2e-18 BLAST
Pfam:WD40_3 508 564 2.7e-32 PFAM
low complexity region 1103 1116 N/A INTRINSIC
low complexity region 1259 1268 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the WD (tryptophan-aspartic acid) repeat family, which is a large family of structurally-related proteins known to participate in a wide range of cellular processes. Each WD repeat typically contains about 40 amino acids that are usually bracketed by glycine-histidine and tryptophan-aspartic acid (WD) dipeptides. This protein contains six WD repeats, three transmembrane domains, and a clathrin heavy-chain repeat. Mutations in this gene have been described in individuals with a wide range of disorders affecting function of the cilium. These disorders are known as ciliopathies, and include Jeune syndrome, Sensenbrenner syndromes, Senior-Loken syndrome, combined or isolated nephronophthisis (NPHP), and retinitis pigmentosa (RP). Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E10. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik C T 12: 110,668,541 G188R probably damaging Het
Abhd3 T C 18: 10,645,127 Y384C probably damaging Het
Cd209b T A 8: 3,918,783 E282V probably damaging Het
Cep350 A C 1: 155,928,331 L1002W probably damaging Het
Clcn1 T C 6: 42,298,820 V292A probably damaging Het
Clcn7 T C 17: 25,146,351 I107T possibly damaging Het
Cntrob A G 11: 69,303,092 probably null Het
Crb1 A T 1: 139,231,603 S1294T possibly damaging Het
Cst13 T G 2: 148,823,209 Y41* probably null Het
Gp1ba A G 11: 70,640,313 probably benign Het
Gucy2e A T 11: 69,232,793 L427I probably benign Het
Gucy2g A G 19: 55,233,050 S340P probably damaging Het
Herc1 A G 9: 66,486,078 T4080A probably benign Het
Iglon5 A T 7: 43,476,895 C195S probably damaging Het
Itgae A G 11: 73,111,369 T100A probably damaging Het
Jarid2 C T 13: 44,884,824 S205L probably damaging Het
Macrod2 A T 2: 142,389,875 *424C probably null Het
Map2k6 A T 11: 110,506,714 probably benign Het
Muc4 A T 16: 32,751,810 K563* probably null Het
Myh7b T C 2: 155,631,751 I1568T possibly damaging Het
Myo15b G A 11: 115,866,667 W1114* probably null Het
Mypn T C 10: 63,192,510 Y258C probably damaging Het
Notch1 T C 2: 26,481,574 T288A possibly damaging Het
Npc1 C T 18: 12,198,537 G859R probably damaging Het
Olfm2 T A 9: 20,668,568 R326W probably damaging Het
Olfr1000 A G 2: 85,608,632 S93P probably benign Het
Olfr1043 A G 2: 86,162,019 I310T probably benign Het
Olfr13 T C 6: 43,174,162 Y59H possibly damaging Het
Ovol1 G A 19: 5,560,233 P23L probably damaging Het
Pappa2 C A 1: 158,848,009 V1056F probably damaging Het
Peg10 C CTCA 6: 4,756,453 probably benign Het
Pik3ca T C 3: 32,436,279 L25S probably damaging Het
Pla2r1 T C 2: 60,447,399 H860R possibly damaging Het
Pms1 A T 1: 53,189,382 H902Q probably damaging Het
Ptgs1 T G 2: 36,251,029 L496R probably damaging Het
Ralgapa2 A T 2: 146,346,718 Y1381* probably null Het
Rtl1 T C 12: 109,592,315 Q1030R possibly damaging Het
Ryr3 T A 2: 112,753,078 Y2816F probably benign Het
Sh2b2 T C 5: 136,224,299 T340A possibly damaging Het
Spta1 T C 1: 174,209,352 L1143P probably damaging Het
St8sia5 T C 18: 77,246,180 I178T probably damaging Het
Tap2 A G 17: 34,214,414 N517S possibly damaging Het
Tcp11 A G 17: 28,071,705 Y227H possibly damaging Het
Usp34 A G 11: 23,393,954 D1411G probably benign Het
Vmn2r105 A G 17: 20,209,074 L580P probably damaging Het
Xirp2 T C 2: 67,525,569 V3558A probably benign Het
Xpo7 T C 14: 70,666,023 N1082S probably benign Het
Zbtb49 A T 5: 38,213,367 L390* probably null Het
Zfp639 C A 3: 32,520,112 D295E probably damaging Het
Other mutations in Wdr19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00985:Wdr19 APN 5 65252299 missense probably benign 0.41
IGL01346:Wdr19 APN 5 65221739 splice site probably benign
IGL01761:Wdr19 APN 5 65215820 missense possibly damaging 0.60
IGL01845:Wdr19 APN 5 65225366 missense probably damaging 0.98
IGL01977:Wdr19 APN 5 65228569 missense probably benign
IGL02314:Wdr19 APN 5 65257120 missense probably benign 0.26
IGL02455:Wdr19 APN 5 65224759 missense probably benign 0.01
IGL02542:Wdr19 APN 5 65231071 missense probably benign
IGL02616:Wdr19 APN 5 65223581 missense probably damaging 0.97
IGL02661:Wdr19 APN 5 65245808 missense probably benign 0.06
IGL02927:Wdr19 APN 5 65252378 missense possibly damaging 0.80
IGL02958:Wdr19 APN 5 65212807 splice site probably null
IGL03083:Wdr19 APN 5 65230976 missense probably benign 0.01
IGL03332:Wdr19 APN 5 65227143 missense possibly damaging 0.89
detritus UTSW 5 65212891 missense possibly damaging 0.59
refuse UTSW 5 65228292 missense possibly damaging 0.64
R0924:Wdr19 UTSW 5 65256439 splice site probably benign
R1178:Wdr19 UTSW 5 65223865 missense probably damaging 0.98
R1229:Wdr19 UTSW 5 65256391 missense possibly damaging 0.94
R1434:Wdr19 UTSW 5 65223504 splice site probably benign
R1543:Wdr19 UTSW 5 65224690 missense probably benign 0.06
R1819:Wdr19 UTSW 5 65212891 missense possibly damaging 0.59
R1971:Wdr19 UTSW 5 65241160 splice site probably benign
R2190:Wdr19 UTSW 5 65244166 missense possibly damaging 0.89
R2274:Wdr19 UTSW 5 65240991 missense possibly damaging 0.62
R3106:Wdr19 UTSW 5 65202623 missense probably benign 0.20
R3753:Wdr19 UTSW 5 65224726 missense probably damaging 1.00
R3893:Wdr19 UTSW 5 65228292 missense possibly damaging 0.64
R4609:Wdr19 UTSW 5 65228542 missense possibly damaging 0.83
R5284:Wdr19 UTSW 5 65225409 missense probably damaging 1.00
R5328:Wdr19 UTSW 5 65244179 missense probably damaging 1.00
R5530:Wdr19 UTSW 5 65228219 missense probably benign
R5837:Wdr19 UTSW 5 65202957 missense probably benign 0.08
R5902:Wdr19 UTSW 5 65227139 missense probably benign 0.09
R6065:Wdr19 UTSW 5 65221713 missense probably benign
R6419:Wdr19 UTSW 5 65215893 missense possibly damaging 0.63
R6495:Wdr19 UTSW 5 65258123 missense probably benign 0.00
R6916:Wdr19 UTSW 5 65225334 missense possibly damaging 0.64
X0028:Wdr19 UTSW 5 65244144 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAGACTTCATCGCACAGTGTG -3'
(R):5'- AGCATGTGTAAATTAGAAGCTTCCCC -3'

Sequencing Primer
(F):5'- TTCTGGACGCAGATATCTGAACAGC -3'
(R):5'- TCCCCCTGAAGCTGTGATTGG -3'
Posted On2019-05-13