Incidental Mutation 'R7020:Clcn1'
ID 545566
Institutional Source Beutler Lab
Gene Symbol Clcn1
Ensembl Gene ENSMUSG00000029862
Gene Name chloride channel, voltage-sensitive 1
Synonyms Clc1, SMCC1, NMF355, Clc-1, nmf355
MMRRC Submission 045121-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7020 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 42263619-42292690 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 42275754 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 292 (V292A)
Ref Sequence ENSEMBL: ENSMUSP00000031894 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031894] [ENSMUST00000164091] [ENSMUST00000168660]
AlphaFold Q64347
Predicted Effect probably damaging
Transcript: ENSMUST00000031894
AA Change: V292A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000031894
Gene: ENSMUSG00000029862
AA Change: V292A

DomainStartEndE-ValueType
low complexity region 121 130 N/A INTRINSIC
Pfam:Voltage_CLC 170 572 3.2e-87 PFAM
Blast:CBS 612 662 1e-24 BLAST
low complexity region 723 747 N/A INTRINSIC
Blast:CBS 830 877 4e-19 BLAST
low complexity region 928 950 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163936
SMART Domains Protein: ENSMUSP00000130148
Gene: ENSMUSG00000029862

DomainStartEndE-ValueType
low complexity region 92 101 N/A INTRINSIC
Pfam:Voltage_CLC 141 261 1.2e-27 PFAM
Pfam:Voltage_CLC 258 501 3.9e-44 PFAM
PDB:2D4Z|B 520 807 2e-47 PDB
Blast:CBS 541 591 2e-24 BLAST
Blast:CBS 759 806 3e-19 BLAST
low complexity region 857 879 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164091
SMART Domains Protein: ENSMUSP00000131354
Gene: ENSMUSG00000029862

DomainStartEndE-ValueType
low complexity region 121 130 N/A INTRINSIC
Pfam:Voltage_CLC 170 256 2.9e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165780
SMART Domains Protein: ENSMUSP00000130550
Gene: ENSMUSG00000029862

DomainStartEndE-ValueType
low complexity region 92 101 N/A INTRINSIC
Pfam:Voltage_CLC 141 227 9.7e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168660
SMART Domains Protein: ENSMUSP00000126045
Gene: ENSMUSG00000029862

DomainStartEndE-ValueType
low complexity region 88 97 N/A INTRINSIC
Pfam:Voltage_CLC 136 257 1.1e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169024
SMART Domains Protein: ENSMUSP00000130968
Gene: ENSMUSG00000029862

DomainStartEndE-ValueType
low complexity region 92 101 N/A INTRINSIC
Pfam:Voltage_CLC 141 261 2.9e-24 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000132154
Gene: ENSMUSG00000029862
AA Change: S236P

DomainStartEndE-ValueType
low complexity region 92 101 N/A INTRINSIC
Pfam:Voltage_CLC 141 235 8e-22 PFAM
Meta Mutation Damage Score 0.8130 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The CLCN family of voltage-dependent chloride channel genes comprises nine members (CLCN1-7, Ka and Kb) which demonstrate quite diverse functional characteristics while sharing significant sequence homology. The protein encoded by this gene regulates the electric excitability of the skeletal muscle membrane. Mutations in this gene cause two forms of inherited human muscle disorders: recessive generalized myotonia congenita (Becker) and dominant myotonia (Thomsen). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mutant mice exhibit mild to severe spasms of the hind limbs and abnormal hind limb reflexes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik C T 12: 110,634,975 (GRCm39) G188R probably damaging Het
Abhd3 T C 18: 10,645,127 (GRCm39) Y384C probably damaging Het
Cd209b T A 8: 3,968,783 (GRCm39) E282V probably damaging Het
Cep350 A C 1: 155,804,077 (GRCm39) L1002W probably damaging Het
Clcn7 T C 17: 25,365,325 (GRCm39) I107T possibly damaging Het
Cntrob A G 11: 69,193,918 (GRCm39) probably null Het
Crb1 A T 1: 139,159,341 (GRCm39) S1294T possibly damaging Het
Cst13 T G 2: 148,665,129 (GRCm39) Y41* probably null Het
Gp1ba A G 11: 70,531,139 (GRCm39) probably benign Het
Gucy2e A T 11: 69,123,619 (GRCm39) L427I probably benign Het
Gucy2g A G 19: 55,221,482 (GRCm39) S340P probably damaging Het
Herc1 A G 9: 66,393,360 (GRCm39) T4080A probably benign Het
Iglon5 A T 7: 43,126,319 (GRCm39) C195S probably damaging Het
Itgae A G 11: 73,002,195 (GRCm39) T100A probably damaging Het
Jarid2 C T 13: 45,038,300 (GRCm39) S205L probably damaging Het
Macrod2 A T 2: 142,231,795 (GRCm39) *424C probably null Het
Map2k6 A T 11: 110,397,540 (GRCm39) probably benign Het
Muc4 A T 16: 32,570,628 (GRCm39) K563* probably null Het
Myh7b T C 2: 155,473,671 (GRCm39) I1568T possibly damaging Het
Myo15b G A 11: 115,757,493 (GRCm39) W1114* probably null Het
Mypn T C 10: 63,028,289 (GRCm39) Y258C probably damaging Het
Notch1 T C 2: 26,371,586 (GRCm39) T288A possibly damaging Het
Npc1 C T 18: 12,331,594 (GRCm39) G859R probably damaging Het
Olfm2 T A 9: 20,579,864 (GRCm39) R326W probably damaging Het
Or2a7 T C 6: 43,151,096 (GRCm39) Y59H possibly damaging Het
Or5al7 A G 2: 85,992,363 (GRCm39) I310T probably benign Het
Or5g23 A G 2: 85,438,976 (GRCm39) S93P probably benign Het
Ovol1 G A 19: 5,610,261 (GRCm39) P23L probably damaging Het
Pappa2 C A 1: 158,675,579 (GRCm39) V1056F probably damaging Het
Pik3ca T C 3: 32,490,428 (GRCm39) L25S probably damaging Het
Pla2r1 T C 2: 60,277,743 (GRCm39) H860R possibly damaging Het
Pms1 A T 1: 53,228,541 (GRCm39) H902Q probably damaging Het
Ptgs1 T G 2: 36,141,041 (GRCm39) L496R probably damaging Het
Ralgapa2 A T 2: 146,188,638 (GRCm39) Y1381* probably null Het
Rtl1 T C 12: 109,558,749 (GRCm39) Q1030R possibly damaging Het
Ryr3 T A 2: 112,583,423 (GRCm39) Y2816F probably benign Het
Sh2b2 T C 5: 136,253,153 (GRCm39) T340A possibly damaging Het
Slc30a5 T A 13: 100,961,421 (GRCm39) probably null Het
Spta1 T C 1: 174,036,918 (GRCm39) L1143P probably damaging Het
St8sia5 T C 18: 77,333,876 (GRCm39) I178T probably damaging Het
Tap2 A G 17: 34,433,388 (GRCm39) N517S possibly damaging Het
Tcp11 A G 17: 28,290,679 (GRCm39) Y227H possibly damaging Het
Usp34 A G 11: 23,343,954 (GRCm39) D1411G probably benign Het
Vmn2r105 A G 17: 20,429,336 (GRCm39) L580P probably damaging Het
Wdr19 A G 5: 65,413,657 (GRCm39) E1200G probably damaging Het
Xirp2 T C 2: 67,355,913 (GRCm39) V3558A probably benign Het
Xpo7 T C 14: 70,903,463 (GRCm39) N1082S probably benign Het
Zbtb49 A T 5: 38,370,711 (GRCm39) L390* probably null Het
Zfp639 C A 3: 32,574,261 (GRCm39) D295E probably damaging Het
Other mutations in Clcn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01473:Clcn1 APN 6 42,268,637 (GRCm39) missense probably damaging 1.00
IGL01732:Clcn1 APN 6 42,287,606 (GRCm39) splice site probably benign
IGL02055:Clcn1 APN 6 42,284,489 (GRCm39) missense probably damaging 1.00
IGL02507:Clcn1 APN 6 42,284,007 (GRCm39) splice site probably benign
IGL02649:Clcn1 APN 6 42,275,763 (GRCm39) missense probably damaging 1.00
IGL02739:Clcn1 APN 6 42,263,714 (GRCm39) splice site probably null
IGL03148:Clcn1 APN 6 42,276,925 (GRCm39) critical splice donor site probably null
IGL03190:Clcn1 APN 6 42,267,037 (GRCm39) missense probably benign 0.02
IGL03327:Clcn1 APN 6 42,288,153 (GRCm39) missense probably benign 0.00
IGL03346:Clcn1 APN 6 42,288,153 (GRCm39) missense probably benign 0.00
Faint UTSW 6 42,284,199 (GRCm39) missense probably damaging 1.00
jack_spratt UTSW 6 42,287,515 (GRCm39) missense probably benign
Limitations UTSW 6 42,286,997 (GRCm39) missense possibly damaging 0.79
maimed UTSW 6 42,275,754 (GRCm39) missense probably damaging 1.00
stunted UTSW 6 42,263,701 (GRCm39) start codon destroyed possibly damaging 0.79
R0167:Clcn1 UTSW 6 42,263,770 (GRCm39) missense probably damaging 1.00
R0323:Clcn1 UTSW 6 42,287,074 (GRCm39) missense probably damaging 0.99
R0491:Clcn1 UTSW 6 42,287,515 (GRCm39) missense probably benign
R0573:Clcn1 UTSW 6 42,289,979 (GRCm39) splice site probably null
R0615:Clcn1 UTSW 6 42,282,509 (GRCm39) missense probably damaging 1.00
R0944:Clcn1 UTSW 6 42,290,075 (GRCm39) missense probably benign 0.00
R1562:Clcn1 UTSW 6 42,277,169 (GRCm39) missense probably benign 0.29
R1566:Clcn1 UTSW 6 42,268,374 (GRCm39) missense possibly damaging 0.58
R1692:Clcn1 UTSW 6 42,290,032 (GRCm39) missense possibly damaging 0.67
R1728:Clcn1 UTSW 6 42,276,448 (GRCm39) missense possibly damaging 0.86
R1729:Clcn1 UTSW 6 42,276,448 (GRCm39) missense possibly damaging 0.86
R1772:Clcn1 UTSW 6 42,271,079 (GRCm39) missense probably damaging 1.00
R1784:Clcn1 UTSW 6 42,276,448 (GRCm39) missense possibly damaging 0.86
R1793:Clcn1 UTSW 6 42,275,860 (GRCm39) critical splice donor site probably null
R1861:Clcn1 UTSW 6 42,290,925 (GRCm39) missense possibly damaging 0.63
R1864:Clcn1 UTSW 6 42,282,475 (GRCm39) missense probably damaging 1.00
R1865:Clcn1 UTSW 6 42,282,475 (GRCm39) missense probably damaging 1.00
R2356:Clcn1 UTSW 6 42,268,559 (GRCm39) missense probably damaging 1.00
R2403:Clcn1 UTSW 6 42,290,046 (GRCm39) missense probably damaging 0.99
R2987:Clcn1 UTSW 6 42,275,784 (GRCm39) missense probably damaging 1.00
R3082:Clcn1 UTSW 6 42,267,112 (GRCm39) missense probably damaging 0.98
R3500:Clcn1 UTSW 6 42,269,929 (GRCm39) missense probably damaging 0.99
R3747:Clcn1 UTSW 6 42,276,849 (GRCm39) missense probably damaging 1.00
R3748:Clcn1 UTSW 6 42,276,849 (GRCm39) missense probably damaging 1.00
R4041:Clcn1 UTSW 6 42,286,902 (GRCm39) missense probably damaging 1.00
R4749:Clcn1 UTSW 6 42,267,131 (GRCm39) splice site probably null
R4836:Clcn1 UTSW 6 42,286,898 (GRCm39) missense probably damaging 0.96
R5021:Clcn1 UTSW 6 42,287,922 (GRCm39) nonsense probably null
R5085:Clcn1 UTSW 6 42,290,814 (GRCm39) missense probably benign 0.41
R5528:Clcn1 UTSW 6 42,277,275 (GRCm39) missense probably benign 0.01
R5628:Clcn1 UTSW 6 42,275,823 (GRCm39) missense probably damaging 0.96
R5678:Clcn1 UTSW 6 42,284,199 (GRCm39) missense probably damaging 1.00
R5943:Clcn1 UTSW 6 42,269,900 (GRCm39) missense probably damaging 1.00
R6053:Clcn1 UTSW 6 42,277,208 (GRCm39) nonsense probably null
R6175:Clcn1 UTSW 6 42,291,096 (GRCm39) missense probably damaging 1.00
R6394:Clcn1 UTSW 6 42,290,172 (GRCm39) missense possibly damaging 0.82
R6394:Clcn1 UTSW 6 42,284,524 (GRCm39) missense possibly damaging 0.84
R7012:Clcn1 UTSW 6 42,267,542 (GRCm39) missense probably benign 0.01
R7048:Clcn1 UTSW 6 42,284,477 (GRCm39) missense probably damaging 1.00
R7212:Clcn1 UTSW 6 42,268,323 (GRCm39) missense possibly damaging 0.46
R7225:Clcn1 UTSW 6 42,270,396 (GRCm39) missense probably damaging 1.00
R7264:Clcn1 UTSW 6 42,275,772 (GRCm39) missense probably damaging 1.00
R7636:Clcn1 UTSW 6 42,268,268 (GRCm39) nonsense probably null
R7663:Clcn1 UTSW 6 42,286,997 (GRCm39) missense possibly damaging 0.79
R7807:Clcn1 UTSW 6 42,287,282 (GRCm39) splice site probably null
R7954:Clcn1 UTSW 6 42,263,625 (GRCm39) unclassified probably benign
R8026:Clcn1 UTSW 6 42,284,595 (GRCm39) critical splice donor site probably null
R8045:Clcn1 UTSW 6 42,267,628 (GRCm39) missense probably damaging 1.00
R8499:Clcn1 UTSW 6 42,284,133 (GRCm39) missense probably damaging 1.00
R8523:Clcn1 UTSW 6 42,284,523 (GRCm39) nonsense probably null
R8677:Clcn1 UTSW 6 42,267,519 (GRCm39) critical splice acceptor site probably null
R8818:Clcn1 UTSW 6 42,282,477 (GRCm39) missense probably damaging 0.98
R8945:Clcn1 UTSW 6 42,263,701 (GRCm39) start codon destroyed possibly damaging 0.79
R9012:Clcn1 UTSW 6 42,268,567 (GRCm39) missense possibly damaging 0.75
R9295:Clcn1 UTSW 6 42,290,883 (GRCm39) missense probably benign 0.00
R9433:Clcn1 UTSW 6 42,282,494 (GRCm39) missense probably damaging 1.00
R9513:Clcn1 UTSW 6 42,282,462 (GRCm39) missense probably damaging 1.00
R9679:Clcn1 UTSW 6 42,263,753 (GRCm39) missense probably damaging 0.98
Z1088:Clcn1 UTSW 6 42,284,190 (GRCm39) missense probably damaging 1.00
Z1088:Clcn1 UTSW 6 42,277,294 (GRCm39) missense probably benign 0.40
Z1176:Clcn1 UTSW 6 42,284,501 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCTCCATAGACAAGTATGTGAC -3'
(R):5'- GGTCTTCCTTCCCAGACAAC -3'

Sequencing Primer
(F):5'- CTCCATAGACAAGTATGTGACTGTAG -3'
(R):5'- TCTTATCTAAAGTGCTCCAGAGC -3'
Posted On 2019-05-13