Incidental Mutation 'R7020:Clcn7'
ID 545586
Institutional Source Beutler Lab
Gene Symbol Clcn7
Ensembl Gene ENSMUSG00000036636
Gene Name chloride channel, voltage-sensitive 7
Synonyms ClC-7
MMRRC Submission 045121-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7020 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 25352365-25381078 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 25365325 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 107 (I107T)
Ref Sequence ENSEMBL: ENSMUSP00000124194 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040729] [ENSMUST00000160961]
AlphaFold O70496
Predicted Effect possibly damaging
Transcript: ENSMUST00000040729
AA Change: I127T

PolyPhen 2 Score 0.757 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000035964
Gene: ENSMUSG00000036636
AA Change: I127T

DomainStartEndE-ValueType
low complexity region 60 74 N/A INTRINSIC
Pfam:Voltage_CLC 183 594 1.5e-96 PFAM
CBS 632 687 8.38e-4 SMART
CBS 742 790 1.77e-11 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000125546
Gene: ENSMUSG00000036636
AA Change: I20T

DomainStartEndE-ValueType
Pfam:Voltage_CLC 76 202 5.3e-34 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000160961
AA Change: I107T

PolyPhen 2 Score 0.757 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000124194
Gene: ENSMUSG00000036636
AA Change: I107T

DomainStartEndE-ValueType
low complexity region 8 25 N/A INTRINSIC
low complexity region 40 54 N/A INTRINSIC
Pfam:Voltage_CLC 163 574 1.5e-93 PFAM
CBS 612 667 8.38e-4 SMART
CBS 722 770 1.77e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162862
SMART Domains Protein: ENSMUSP00000124527
Gene: ENSMUSG00000036636

DomainStartEndE-ValueType
Pfam:Voltage_CLC 5 307 1.3e-48 PFAM
Meta Mutation Damage Score 0.1200 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the CLC chloride channel family of proteins. Chloride channels play important roles in the plasma membrane and in intracellular organelles. This gene encodes chloride channel 7. Defects in this gene are the cause of osteopetrosis autosomal recessive type 4 (OPTB4), also called infantile malignant osteopetrosis type 2 as well as the cause of autosomal dominant osteopetrosis type 2 (OPTA2), also called autosomal dominant Albers-Schonberg disease or marble disease autosoml dominant. Osteopetrosis is a rare genetic disease characterized by abnormally dense bone, due to defective resorption of immature bone. OPTA2 is the most common form of osteopetrosis, occurring in adolescence or adulthood. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit postnatal lethality, abnormal bone formation, including osteopetrosis, and retinal degeneration. Mice homozygous for a conditional allele exhibit lysosomal defects with neuronal degeneration and accumulationof giant lysosomes in renal tubule cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik C T 12: 110,634,975 (GRCm39) G188R probably damaging Het
Abhd3 T C 18: 10,645,127 (GRCm39) Y384C probably damaging Het
Cd209b T A 8: 3,968,783 (GRCm39) E282V probably damaging Het
Cep350 A C 1: 155,804,077 (GRCm39) L1002W probably damaging Het
Clcn1 T C 6: 42,275,754 (GRCm39) V292A probably damaging Het
Cntrob A G 11: 69,193,918 (GRCm39) probably null Het
Crb1 A T 1: 139,159,341 (GRCm39) S1294T possibly damaging Het
Cst13 T G 2: 148,665,129 (GRCm39) Y41* probably null Het
Gp1ba A G 11: 70,531,139 (GRCm39) probably benign Het
Gucy2e A T 11: 69,123,619 (GRCm39) L427I probably benign Het
Gucy2g A G 19: 55,221,482 (GRCm39) S340P probably damaging Het
Herc1 A G 9: 66,393,360 (GRCm39) T4080A probably benign Het
Iglon5 A T 7: 43,126,319 (GRCm39) C195S probably damaging Het
Itgae A G 11: 73,002,195 (GRCm39) T100A probably damaging Het
Jarid2 C T 13: 45,038,300 (GRCm39) S205L probably damaging Het
Macrod2 A T 2: 142,231,795 (GRCm39) *424C probably null Het
Map2k6 A T 11: 110,397,540 (GRCm39) probably benign Het
Muc4 A T 16: 32,570,628 (GRCm39) K563* probably null Het
Myh7b T C 2: 155,473,671 (GRCm39) I1568T possibly damaging Het
Myo15b G A 11: 115,757,493 (GRCm39) W1114* probably null Het
Mypn T C 10: 63,028,289 (GRCm39) Y258C probably damaging Het
Notch1 T C 2: 26,371,586 (GRCm39) T288A possibly damaging Het
Npc1 C T 18: 12,331,594 (GRCm39) G859R probably damaging Het
Olfm2 T A 9: 20,579,864 (GRCm39) R326W probably damaging Het
Or2a7 T C 6: 43,151,096 (GRCm39) Y59H possibly damaging Het
Or5al7 A G 2: 85,992,363 (GRCm39) I310T probably benign Het
Or5g23 A G 2: 85,438,976 (GRCm39) S93P probably benign Het
Ovol1 G A 19: 5,610,261 (GRCm39) P23L probably damaging Het
Pappa2 C A 1: 158,675,579 (GRCm39) V1056F probably damaging Het
Pik3ca T C 3: 32,490,428 (GRCm39) L25S probably damaging Het
Pla2r1 T C 2: 60,277,743 (GRCm39) H860R possibly damaging Het
Pms1 A T 1: 53,228,541 (GRCm39) H902Q probably damaging Het
Ptgs1 T G 2: 36,141,041 (GRCm39) L496R probably damaging Het
Ralgapa2 A T 2: 146,188,638 (GRCm39) Y1381* probably null Het
Rtl1 T C 12: 109,558,749 (GRCm39) Q1030R possibly damaging Het
Ryr3 T A 2: 112,583,423 (GRCm39) Y2816F probably benign Het
Sh2b2 T C 5: 136,253,153 (GRCm39) T340A possibly damaging Het
Slc30a5 T A 13: 100,961,421 (GRCm39) probably null Het
Spta1 T C 1: 174,036,918 (GRCm39) L1143P probably damaging Het
St8sia5 T C 18: 77,333,876 (GRCm39) I178T probably damaging Het
Tap2 A G 17: 34,433,388 (GRCm39) N517S possibly damaging Het
Tcp11 A G 17: 28,290,679 (GRCm39) Y227H possibly damaging Het
Usp34 A G 11: 23,343,954 (GRCm39) D1411G probably benign Het
Vmn2r105 A G 17: 20,429,336 (GRCm39) L580P probably damaging Het
Wdr19 A G 5: 65,413,657 (GRCm39) E1200G probably damaging Het
Xirp2 T C 2: 67,355,913 (GRCm39) V3558A probably benign Het
Xpo7 T C 14: 70,903,463 (GRCm39) N1082S probably benign Het
Zbtb49 A T 5: 38,370,711 (GRCm39) L390* probably null Het
Zfp639 C A 3: 32,574,261 (GRCm39) D295E probably damaging Het
Other mutations in Clcn7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Clcn7 APN 17 25,370,097 (GRCm39) missense probably damaging 1.00
IGL01735:Clcn7 APN 17 25,370,090 (GRCm39) missense probably benign 0.13
IGL01912:Clcn7 APN 17 25,371,983 (GRCm39) splice site probably benign
IGL01936:Clcn7 APN 17 25,374,350 (GRCm39) missense probably benign 0.44
IGL02084:Clcn7 APN 17 25,376,899 (GRCm39) missense probably benign
IGL02121:Clcn7 APN 17 25,372,058 (GRCm39) missense possibly damaging 0.95
IGL02160:Clcn7 APN 17 25,368,004 (GRCm39) unclassified probably benign
IGL02335:Clcn7 APN 17 25,365,821 (GRCm39) missense probably benign 0.00
IGL02507:Clcn7 APN 17 25,363,443 (GRCm39) missense probably damaging 1.00
IGL02605:Clcn7 APN 17 25,365,792 (GRCm39) missense possibly damaging 0.60
IGL03160:Clcn7 APN 17 25,365,427 (GRCm39) unclassified probably benign
IGL03192:Clcn7 APN 17 25,352,575 (GRCm39) missense probably benign 0.00
IGL03194:Clcn7 APN 17 25,369,522 (GRCm39) missense probably damaging 0.98
IGL03409:Clcn7 APN 17 25,374,359 (GRCm39) missense probably damaging 1.00
R0140:Clcn7 UTSW 17 25,372,728 (GRCm39) missense probably damaging 1.00
R0153:Clcn7 UTSW 17 25,368,176 (GRCm39) unclassified probably benign
R0970:Clcn7 UTSW 17 25,370,208 (GRCm39) critical splice donor site probably null
R1644:Clcn7 UTSW 17 25,378,672 (GRCm39) missense probably damaging 1.00
R1856:Clcn7 UTSW 17 25,379,445 (GRCm39) missense probably damaging 1.00
R2145:Clcn7 UTSW 17 25,363,425 (GRCm39) missense probably benign
R2173:Clcn7 UTSW 17 25,364,583 (GRCm39) missense probably benign
R2401:Clcn7 UTSW 17 25,372,114 (GRCm39) missense probably benign 0.02
R2511:Clcn7 UTSW 17 25,374,420 (GRCm39) missense probably damaging 1.00
R3683:Clcn7 UTSW 17 25,369,567 (GRCm39) missense possibly damaging 0.84
R3684:Clcn7 UTSW 17 25,369,567 (GRCm39) missense possibly damaging 0.84
R3694:Clcn7 UTSW 17 25,378,681 (GRCm39) missense probably damaging 0.99
R4424:Clcn7 UTSW 17 25,379,150 (GRCm39) missense probably damaging 1.00
R4681:Clcn7 UTSW 17 25,376,935 (GRCm39) missense probably damaging 1.00
R4870:Clcn7 UTSW 17 25,372,539 (GRCm39) intron probably benign
R5372:Clcn7 UTSW 17 25,376,153 (GRCm39) missense possibly damaging 0.82
R5820:Clcn7 UTSW 17 25,368,026 (GRCm39) missense probably damaging 1.00
R6154:Clcn7 UTSW 17 25,376,928 (GRCm39) missense probably damaging 0.98
R6181:Clcn7 UTSW 17 25,370,702 (GRCm39) missense possibly damaging 0.79
R6306:Clcn7 UTSW 17 25,376,502 (GRCm39) missense probably benign 0.01
R6798:Clcn7 UTSW 17 25,378,734 (GRCm39) missense probably damaging 1.00
R6961:Clcn7 UTSW 17 25,376,188 (GRCm39) missense probably damaging 1.00
R7089:Clcn7 UTSW 17 25,372,667 (GRCm39) missense
R7757:Clcn7 UTSW 17 25,375,796 (GRCm39) missense probably damaging 1.00
R8057:Clcn7 UTSW 17 25,368,233 (GRCm39) nonsense probably null
R8670:Clcn7 UTSW 17 25,378,588 (GRCm39) missense probably damaging 0.99
R9031:Clcn7 UTSW 17 25,376,497 (GRCm39) missense probably damaging 0.96
R9720:Clcn7 UTSW 17 25,374,471 (GRCm39) missense probably damaging 1.00
X0020:Clcn7 UTSW 17 25,369,200 (GRCm39) missense probably damaging 1.00
Z1177:Clcn7 UTSW 17 25,371,989 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CATTGGCTGGAGTCTGCTTC -3'
(R):5'- GTAGGTGATCTCTATGGAGCCC -3'

Sequencing Primer
(F):5'- GCTTCTGGCAGGCTTGG -3'
(R):5'- TACTGCCTGCCTATGAAGACG -3'
Posted On 2019-05-13