Incidental Mutation 'R7021:Muc16'
ID545632
Institutional Source Beutler Lab
Gene Symbol Muc16
Ensembl Gene ENSMUSG00000109564
Gene Namemucin 16
Synonyms1110008I14Rik, LOC385009
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.164) question?
Stock #R7021 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location18495455-18674530 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 18554919 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 7368 (H7368N)
Ref Sequence ENSEMBL: ENSMUSP00000147104 (fasta)
Predicted Effect
Predicted Effect unknown
Transcript: ENSMUST00000208663
AA Change: H7368N
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 99% (75/76)
MGI Phenotype PHENOTYPE: Homozygous null mice are viable and fertile with no gross histological abnormalities. Homozygous male mice father larger litters when crossed to wild-type females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 C T 12: 118,931,925 V379I probably benign Het
Adamts15 T C 9: 30,921,480 Y253C probably damaging Het
Ahsa1 T C 12: 87,271,380 S37P possibly damaging Het
Arnt2 A T 7: 84,343,942 L130H probably damaging Het
Atp8b5 T A 4: 43,355,618 F533I probably damaging Het
Best1 A G 19: 9,986,779 V439A probably benign Het
Bicc1 A G 10: 70,961,148 V127A probably damaging Het
Brd7 T C 8: 88,347,004 T253A probably benign Het
Btd A G 14: 31,667,831 D503G probably benign Het
Ccdc80 A G 16: 45,104,441 E646G probably damaging Het
Ccl25 A G 8: 4,349,641 probably benign Het
Ccnf C A 17: 24,242,231 W150L probably damaging Het
Cdk11b A T 4: 155,641,567 probably benign Het
Cfap73 T C 5: 120,630,084 E203G probably benign Het
Cmya5 T C 13: 93,093,555 E1675G possibly damaging Het
Copg1 T A 6: 87,894,105 Y268N possibly damaging Het
Csnk2a1 T A 2: 152,260,812 H126Q probably damaging Het
Ctbs G A 3: 146,454,948 G90D probably damaging Het
Ctnna2 T C 6: 77,636,905 Y221C probably damaging Het
Cypt12 C T 3: 17,948,471 R3C unknown Het
D630003M21Rik A T 2: 158,216,750 M410K possibly damaging Het
Dnah9 A T 11: 65,981,231 N2724K probably benign Het
Dok3 T C 13: 55,524,284 T194A probably benign Het
Edem3 T G 1: 151,755,672 S36A probably benign Het
Eed C T 7: 89,980,519 E3K possibly damaging Het
Efcab2 A G 1: 178,481,360 I143V probably benign Het
Ensa A T 3: 95,627,048 probably null Het
Galnt16 A T 12: 80,580,052 E219V probably damaging Het
Gfra3 C A 18: 34,690,880 R347L probably benign Het
Gm13178 A C 4: 144,715,492 L63R probably damaging Het
Gm2042 T A 12: 87,960,239 I442K probably damaging Het
Gpld1 A T 13: 24,984,708 D735V probably damaging Het
Hspg2 T C 4: 137,542,269 S2253P possibly damaging Het
Kit T C 5: 75,620,967 I352T probably benign Het
Klra6 A T 6: 130,018,858 V179E possibly damaging Het
Lctl T A 9: 64,132,793 probably null Het
Lman1 C A 18: 65,991,643 V342L probably benign Het
Lrrn2 T C 1: 132,938,784 L529P probably damaging Het
Mab21l2 A G 3: 86,547,486 I69T probably benign Het
Mapkapk5 G T 5: 121,527,211 A327E probably benign Het
Mex3b G T 7: 82,869,872 R465L possibly damaging Het
Mgat3 A G 15: 80,212,454 N494S probably damaging Het
Mgat4c A G 10: 102,388,428 R168G possibly damaging Het
Mkks A G 2: 136,876,087 probably null Het
Nbeal1 G A 1: 60,261,586 probably null Het
Notch2 T C 3: 98,135,446 S1376P probably benign Het
Obox5 A G 7: 15,757,756 probably null Het
Olfr16 T C 1: 172,956,927 I44T probably benign Het
Olfr765 A T 10: 129,047,030 I11N probably damaging Het
Pbrm1 A G 14: 31,067,816 I807V probably damaging Het
Pitrm1 T A 13: 6,578,557 V962E probably damaging Het
Pkd2l1 T C 19: 44,154,208 Q465R probably damaging Het
Pla1a A G 16: 38,400,882 I372T probably damaging Het
Prmt5 A C 14: 54,515,388 F122C probably damaging Het
Prrc2b T A 2: 32,221,486 S1905T probably damaging Het
Ptprf T G 4: 118,223,904 K1163N probably benign Het
Rab3ip A G 10: 116,939,378 V25A probably damaging Het
Raf1 T C 6: 115,620,339 probably null Het
Rnf180 T C 13: 105,270,921 E40G probably benign Het
Rpl6 T A 5: 121,208,909 M289K probably benign Het
Slc25a32 A G 15: 39,099,926 F167L probably benign Het
Slc30a2 G A 4: 134,347,415 R161Q probably damaging Het
Slc4a4 T A 5: 89,040,346 probably null Het
Sppl2a A G 2: 126,927,743 probably null Het
Tbr1 T A 2: 61,807,344 D82E probably benign Het
Tbx10 A T 19: 3,998,961 T291S probably benign Het
Tlr1 T A 5: 64,925,713 H507L possibly damaging Het
Trim37 A C 11: 87,167,509 T338P probably benign Het
Trpv5 T C 6: 41,653,270 T629A probably benign Het
Ttc14 T A 3: 33,803,497 I249N probably damaging Het
Uhrf1 A G 17: 56,320,450 T661A probably benign Het
Vmn2r65 A G 7: 84,947,379 I156T probably benign Het
Vwde T C 6: 13,186,906 N861D probably damaging Het
Zan A G 5: 137,423,951 C2802R unknown Het
Other mutations in Muc16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01330:Muc16 APN 9 18508507 missense possibly damaging 0.89
IGL01878:Muc16 APN 9 18495543 missense possibly damaging 0.90
IGL02394:Muc16 APN 9 18498700 missense probably damaging 0.99
IGL02553:Muc16 APN 9 18498553 critical splice donor site probably null
R0400:Muc16 UTSW 9 18510534 missense possibly damaging 0.74
R1620:Muc16 UTSW 9 18510477 missense possibly damaging 0.89
R1695:Muc16 UTSW 9 18497433 missense probably damaging 1.00
R3196:Muc16 UTSW 9 18497830 missense probably damaging 1.00
R5982:Muc16 UTSW 9 18647146 missense unknown
R5990:Muc16 UTSW 9 18659243 missense unknown
R6024:Muc16 UTSW 9 18646671 missense unknown
R6026:Muc16 UTSW 9 18659858 missense unknown
R6028:Muc16 UTSW 9 18657176 missense unknown
R6083:Muc16 UTSW 9 18657212 missense unknown
R6089:Muc16 UTSW 9 18643252 missense unknown
R6109:Muc16 UTSW 9 18655359 missense unknown
R6127:Muc16 UTSW 9 18657878 missense unknown
R6130:Muc16 UTSW 9 18590698 missense probably damaging 1.00
R6146:Muc16 UTSW 9 18497797 missense probably damaging 0.98
R6161:Muc16 UTSW 9 18647818 missense unknown
R6164:Muc16 UTSW 9 18558379 missense probably damaging 1.00
R6185:Muc16 UTSW 9 18654473 missense unknown
R6192:Muc16 UTSW 9 18658689 missense unknown
R6217:Muc16 UTSW 9 18655446 missense unknown
R6232:Muc16 UTSW 9 18656998 missense unknown
R6246:Muc16 UTSW 9 18577067 intron probably null
R6255:Muc16 UTSW 9 18655599 missense unknown
R6280:Muc16 UTSW 9 18579317 critical splice donor site probably null
R6286:Muc16 UTSW 9 18644389 missense unknown
R6287:Muc16 UTSW 9 18659034 missense unknown
R6307:Muc16 UTSW 9 18647588 missense unknown
R6310:Muc16 UTSW 9 18641950 missense probably benign 0.00
R6316:Muc16 UTSW 9 18641819 missense probably benign 0.01
R6335:Muc16 UTSW 9 18660708 missense unknown
R6345:Muc16 UTSW 9 18654926 missense unknown
R6349:Muc16 UTSW 9 18657329 missense unknown
R6366:Muc16 UTSW 9 18646044 missense unknown
R6393:Muc16 UTSW 9 18647399 nonsense probably null
R6440:Muc16 UTSW 9 18641359 missense probably benign 0.01
R6458:Muc16 UTSW 9 18641721 missense probably benign 0.01
R6460:Muc16 UTSW 9 18640516 missense probably benign 0.01
R6481:Muc16 UTSW 9 18550677 critical splice donor site probably null
R6539:Muc16 UTSW 9 18637325 missense probably benign 0.25
R6551:Muc16 UTSW 9 18562562 missense possibly damaging 0.95
R6596:Muc16 UTSW 9 18566715 missense probably benign 0.18
R6601:Muc16 UTSW 9 18637570 missense probably benign 0.10
R6602:Muc16 UTSW 9 18609476 intron probably null
R6615:Muc16 UTSW 9 18647188 missense unknown
R6625:Muc16 UTSW 9 18660278 missense unknown
R6668:Muc16 UTSW 9 18640385 missense probably benign 0.03
R6697:Muc16 UTSW 9 18641291 missense probably benign 0.01
R6710:Muc16 UTSW 9 18642070 missense possibly damaging 0.95
R6727:Muc16 UTSW 9 18566690 critical splice donor site probably null
R6789:Muc16 UTSW 9 18559986 missense probably benign 0.40
R6806:Muc16 UTSW 9 18537910 critical splice donor site probably null
R6874:Muc16 UTSW 9 18658769 nonsense probably null
R6894:Muc16 UTSW 9 18495576 missense possibly damaging 0.92
R6913:Muc16 UTSW 9 18642663 missense unknown
R6919:Muc16 UTSW 9 18660299 missense unknown
R6939:Muc16 UTSW 9 18638537 missense probably benign 0.04
R6953:Muc16 UTSW 9 18640529 missense probably benign 0.01
R6956:Muc16 UTSW 9 18645026 missense unknown
R6977:Muc16 UTSW 9 18645337 missense unknown
R6996:Muc16 UTSW 9 18645897 missense unknown
R7011:Muc16 UTSW 9 18637451 missense probably benign 0.26
R7011:Muc16 UTSW 9 18637543 missense probably benign 0.10
R7012:Muc16 UTSW 9 18495618 critical splice acceptor site probably null
R7014:Muc16 UTSW 9 18658236 missense unknown
R7021:Muc16 UTSW 9 18550831 splice site probably null
R7038:Muc16 UTSW 9 18620468 missense probably damaging 0.99
R7057:Muc16 UTSW 9 18646079 missense unknown
R7058:Muc16 UTSW 9 18639755 missense probably benign 0.10
R7066:Muc16 UTSW 9 18658021 missense unknown
R7067:Muc16 UTSW 9 18658251 missense unknown
R7070:Muc16 UTSW 9 18645923 nonsense probably null
R7074:Muc16 UTSW 9 18655650 missense unknown
R7085:Muc16 UTSW 9 18644849 missense unknown
R7088:Muc16 UTSW 9 18592680 missense probably damaging 0.99
R7107:Muc16 UTSW 9 18637298 missense probably benign 0.10
R7108:Muc16 UTSW 9 18655233 missense unknown
R7126:Muc16 UTSW 9 18641216 missense probably benign 0.01
R7128:Muc16 UTSW 9 18643004 missense unknown
R7145:Muc16 UTSW 9 18655580 missense unknown
R7179:Muc16 UTSW 9 18642008 missense probably benign 0.00
R7194:Muc16 UTSW 9 18674454 missense unknown
R7211:Muc16 UTSW 9 18498570 missense probably damaging 1.00
R7213:Muc16 UTSW 9 18641416 missense probably benign 0.01
R7217:Muc16 UTSW 9 18644076 nonsense probably null
R7221:Muc16 UTSW 9 18642199 missense probably benign 0.04
R7265:Muc16 UTSW 9 18656472 missense unknown
R7326:Muc16 UTSW 9 18585013 missense probably benign 0.03
R7359:Muc16 UTSW 9 18643020 missense unknown
R7387:Muc16 UTSW 9 18641720 missense probably benign 0.01
R7391:Muc16 UTSW 9 18639536 missense probably benign 0.04
R7398:Muc16 UTSW 9 18637742 missense possibly damaging 0.46
R7419:Muc16 UTSW 9 18641962 missense probably benign 0.01
R7431:Muc16 UTSW 9 18607993 missense
R7484:Muc16 UTSW 9 18646768 missense unknown
R7487:Muc16 UTSW 9 18584799 missense possibly damaging 0.93
R7497:Muc16 UTSW 9 18645089 missense unknown
R7515:Muc16 UTSW 9 18639662 missense probably benign 0.00
R7537:Muc16 UTSW 9 18638135 missense probably benign 0.06
R7538:Muc16 UTSW 9 18642131 missense probably benign 0.10
R7538:Muc16 UTSW 9 18655451 missense unknown
R7543:Muc16 UTSW 9 18644732 missense unknown
R7566:Muc16 UTSW 9 18638629 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGACTCGTGTCTTAGATTCAAAAC -3'
(R):5'- CAGCAGGAGGTCTGAATGTC -3'

Sequencing Primer
(F):5'- CGTGTCTTAGATTCAAAACACTCAAG -3'
(R):5'- ATGTCCTCAACATGCACCTC -3'
Posted On2019-05-13