Mutagenetix > Incidental Mutation

Incidental Mutation 'R7021:Ccnf'

545656

Institutional Source

Beutler Lab

Gene Symbol

Ccnf

Ensembl Gene

ENSMUSG00000072082

Gene Name

cyclin F

Synonyms

CycF, Fbxo1

MMRRC Submission

045122-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7021 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

24441518-24470333 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 24461205 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Leucine at position 150 (W150L)

Ref Sequence

ENSEMBL: ENSMUSP00000111048 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000115390]

AlphaFold

P51944

Predicted Effect

probably damaging
Transcript: ENSMUST00000115390
AA Change: W150L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000111048
Gene: ENSMUSG00000072082
AA Change: W150L

Domain	Start	End	E-Value	Type
FBOX	35	75	1.56e-6	SMART
CYCLIN	315	399	2.25e-13	SMART
Cyclin_C	408	531	2.58e-19	SMART
CYCLIN	416	494	2.27e-9	SMART
low complexity region	545	555	N/A	INTRINSIC
low complexity region	563	574	N/A	INTRINSIC
low complexity region	695	708	N/A	INTRINSIC
low complexity region	719	731	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

99% (75/76)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cyclin family. Cyclins are important regulators of cell cycle transitions through their ability to bind and activate cyclin-dependent protein kinases. This member also belongs to the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of the ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class and it was one of the first proteins in which the F-box motif was identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality between E9.5 and E10.5 due to defects in yolk sac and chorioallantoic placenta maturation. Embryos show incomplete turning, underdeveloped posterior structures, neural tube closure and braindefects. MEFs have cell cycle defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
AAdacl4fm3	A	C	4: 144,442,062 (GRCm39)	L63R	probably damaging	Het
Abcb5	C	T	12: 118,895,660 (GRCm39)	V379I	probably benign	Het
Adamts15	T	C	9: 30,832,776 (GRCm39)	Y253C	probably damaging	Het
Ahsa1	T	C	12: 87,318,154 (GRCm39)	S37P	possibly damaging	Het
Arnt2	A	T	7: 83,993,150 (GRCm39)	L130H	probably damaging	Het
Atp8b5	T	A	4: 43,355,618 (GRCm39)	F533I	probably damaging	Het
Best1	A	G	19: 9,964,143 (GRCm39)	V439A	probably benign	Het
Bicc1	A	G	10: 70,796,978 (GRCm39)	V127A	probably damaging	Het
Brd7	T	C	8: 89,073,632 (GRCm39)	T253A	probably benign	Het
Btd	A	G	14: 31,389,788 (GRCm39)	D503G	probably benign	Het
Ccdc80	A	G	16: 44,924,804 (GRCm39)	E646G	probably damaging	Het
Ccl25	A	G	8: 4,399,641 (GRCm39)		probably benign	Het
Cdk11b	A	T	4: 155,726,024 (GRCm39)		probably benign	Het
Cfap73	T	C	5: 120,768,149 (GRCm39)	E203G	probably benign	Het
Cmya5	T	C	13: 93,230,063 (GRCm39)	E1675G	possibly damaging	Het
Copg1	T	A	6: 87,871,087 (GRCm39)	Y268N	possibly damaging	Het
Csnk2a1	T	A	2: 152,102,732 (GRCm39)	H126Q	probably damaging	Het
Ctbs	G	A	3: 146,160,703 (GRCm39)	G90D	probably damaging	Het
Ctnna2	T	C	6: 77,613,888 (GRCm39)	Y221C	probably damaging	Het
Cypt12	C	T	3: 18,002,635 (GRCm39)	R3C	unknown	Het
D630003M21Rik	A	T	2: 158,058,670 (GRCm39)	M410K	possibly damaging	Het
Dnah9	A	T	11: 65,872,057 (GRCm39)	N2724K	probably benign	Het
Dok3	T	C	13: 55,672,097 (GRCm39)	T194A	probably benign	Het
Edem3	T	G	1: 151,631,423 (GRCm39)	S36A	probably benign	Het
Eed	C	T	7: 89,629,727 (GRCm39)	E3K	possibly damaging	Het
Efcab2	A	G	1: 178,308,925 (GRCm39)	I143V	probably benign	Het
Ensa	A	T	3: 95,534,359 (GRCm39)		probably null	Het
Galnt16	A	T	12: 80,626,826 (GRCm39)	E219V	probably damaging	Het
Gfra3	C	A	18: 34,823,933 (GRCm39)	R347L	probably benign	Het
Gm2042	T	A	12: 87,927,009 (GRCm39)	I442K	probably damaging	Het
Gpld1	A	T	13: 25,168,691 (GRCm39)	D735V	probably damaging	Het
Hspg2	T	C	4: 137,269,580 (GRCm39)	S2253P	possibly damaging	Het
Kit	T	C	5: 75,781,627 (GRCm39)	I352T	probably benign	Het
Klra6	A	T	6: 129,995,821 (GRCm39)	V179E	possibly damaging	Het
Lctl	T	A	9: 64,040,075 (GRCm39)		probably null	Het
Lman1	C	A	18: 66,124,714 (GRCm39)	V342L	probably benign	Het
Lrrn2	T	C	1: 132,866,522 (GRCm39)	L529P	probably damaging	Het
Mab21l2	A	G	3: 86,454,793 (GRCm39)	I69T	probably benign	Het
Mapkapk5	G	T	5: 121,665,274 (GRCm39)	A327E	probably benign	Het
Mex3b	G	T	7: 82,519,080 (GRCm39)	R465L	possibly damaging	Het
Mgat3	A	G	15: 80,096,655 (GRCm39)	N494S	probably damaging	Het
Mgat4c	A	G	10: 102,224,289 (GRCm39)	R168G	possibly damaging	Het
Mkks	A	G	2: 136,718,007 (GRCm39)		probably null	Het
Muc16	G	T	9: 18,466,215 (GRCm39)	H7368N	unknown	Het
Muc16	T	C	9: 18,462,127 (GRCm39)		probably null	Het
Nbeal1	G	A	1: 60,300,745 (GRCm39)		probably null	Het
Notch2	T	C	3: 98,042,762 (GRCm39)	S1376P	probably benign	Het
Obox5	A	G	7: 15,491,681 (GRCm39)		probably null	Het
Or10j5	T	C	1: 172,784,494 (GRCm39)	I44T	probably benign	Het
Or6c8b	A	T	10: 128,882,899 (GRCm39)	I11N	probably damaging	Het
Pbrm1	A	G	14: 30,789,773 (GRCm39)	I807V	probably damaging	Het
Pitrm1	T	A	13: 6,628,593 (GRCm39)	V962E	probably damaging	Het
Pkd2l1	T	C	19: 44,142,647 (GRCm39)	Q465R	probably damaging	Het
Pla1a	A	G	16: 38,221,244 (GRCm39)	I372T	probably damaging	Het
Prmt5	A	C	14: 54,752,845 (GRCm39)	F122C	probably damaging	Het
Prrc2b	T	A	2: 32,111,498 (GRCm39)	S1905T	probably damaging	Het
Ptprf	T	G	4: 118,081,101 (GRCm39)	K1163N	probably benign	Het
Rab3ip	A	G	10: 116,775,283 (GRCm39)	V25A	probably damaging	Het
Raf1	T	C	6: 115,597,300 (GRCm39)		probably null	Het
Rnf180	T	C	13: 105,407,429 (GRCm39)	E40G	probably benign	Het
Rpl6	T	A	5: 121,346,972 (GRCm39)	M289K	probably benign	Het
Slc25a32	A	G	15: 38,963,321 (GRCm39)	F167L	probably benign	Het
Slc30a2	G	A	4: 134,074,726 (GRCm39)	R161Q	probably damaging	Het
Slc4a4	T	A	5: 89,188,205 (GRCm39)		probably null	Het
Sppl2a	A	G	2: 126,769,663 (GRCm39)		probably null	Het
Tbr1	T	A	2: 61,637,688 (GRCm39)	D82E	probably benign	Het
Tbx10	A	T	19: 4,048,961 (GRCm39)	T291S	probably benign	Het
Tlr1	T	A	5: 65,083,056 (GRCm39)	H507L	possibly damaging	Het
Trim37	A	C	11: 87,058,335 (GRCm39)	T338P	probably benign	Het
Trpv5	T	C	6: 41,630,204 (GRCm39)	T629A	probably benign	Het
Ttc14	T	A	3: 33,857,646 (GRCm39)	I249N	probably damaging	Het
Uhrf1	A	G	17: 56,627,450 (GRCm39)	T661A	probably benign	Het
Vmn2r65	A	G	7: 84,596,587 (GRCm39)	I156T	probably benign	Het
Vwde	T	C	6: 13,186,905 (GRCm39)	N861D	probably damaging	Het
Zan	A	G	5: 137,422,213 (GRCm39)	C2802R	unknown	Het

Other mutations in Ccnf

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01399:Ccnf	APN	17	24,443,986 (GRCm39)	missense	probably damaging	1.00
IGL01942:Ccnf	APN	17	24,461,294 (GRCm39)	missense	probably benign	0.03
IGL02251:Ccnf	APN	17	24,445,513 (GRCm39)	missense	probably benign	0.00
IGL02945:Ccnf	APN	17	24,443,890 (GRCm39)	missense	probably damaging	0.99
IGL02952:Ccnf	APN	17	24,450,299 (GRCm39)	missense	possibly damaging	0.93
albuquerque	UTSW	17	24,442,971 (GRCm39)	nonsense	probably null
R0326:Ccnf	UTSW	17	24,450,784 (GRCm39)	missense	possibly damaging	0.84
R0891:Ccnf	UTSW	17	24,445,751 (GRCm39)	missense	possibly damaging	0.93
R1069:Ccnf	UTSW	17	24,442,971 (GRCm39)	nonsense	probably null
R1072:Ccnf	UTSW	17	24,456,136 (GRCm39)	missense	probably damaging	0.97
R1693:Ccnf	UTSW	17	24,445,514 (GRCm39)	frame shift	probably null
R2147:Ccnf	UTSW	17	24,449,288 (GRCm39)	critical splice donor site	probably null
R3929:Ccnf	UTSW	17	24,453,356 (GRCm39)	missense	probably damaging	1.00
R4081:Ccnf	UTSW	17	24,442,872 (GRCm39)	makesense	probably null
R4260:Ccnf	UTSW	17	24,445,741 (GRCm39)	missense	probably damaging	1.00
R4579:Ccnf	UTSW	17	24,450,303 (GRCm39)	nonsense	probably null
R4651:Ccnf	UTSW	17	24,450,760 (GRCm39)	missense	probably damaging	1.00
R4844:Ccnf	UTSW	17	24,449,331 (GRCm39)	nonsense	probably null
R4876:Ccnf	UTSW	17	24,449,311 (GRCm39)	missense	probably damaging	1.00
R5234:Ccnf	UTSW	17	24,453,411 (GRCm39)	nonsense	probably null
R5352:Ccnf	UTSW	17	24,462,247 (GRCm39)	splice site	probably null
R5845:Ccnf	UTSW	17	24,459,767 (GRCm39)	missense	possibly damaging	0.95
R6084:Ccnf	UTSW	17	24,450,811 (GRCm39)	missense	probably damaging	1.00
R6219:Ccnf	UTSW	17	24,445,678 (GRCm39)	nonsense	probably null
R7176:Ccnf	UTSW	17	24,468,376 (GRCm39)	missense	possibly damaging	0.54
R7180:Ccnf	UTSW	17	24,442,889 (GRCm39)	missense	probably benign	0.00
R7485:Ccnf	UTSW	17	24,468,232 (GRCm39)	missense	probably damaging	0.97
R7763:Ccnf	UTSW	17	24,443,986 (GRCm39)	missense	probably damaging	1.00
R8016:Ccnf	UTSW	17	24,450,784 (GRCm39)	missense	possibly damaging	0.84
R8034:Ccnf	UTSW	17	24,450,805 (GRCm39)	missense	probably damaging	1.00
R8069:Ccnf	UTSW	17	24,443,989 (GRCm39)	missense	probably damaging	1.00
R9021:Ccnf	UTSW	17	24,445,679 (GRCm39)	nonsense	probably null
R9623:Ccnf	UTSW	17	24,468,367 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTTGACTTTAAACGGCCCAC -3'
(R):5'- CTCCAGAGCTTTGCAGTGTG -3'

Sequencing Primer
(F):5'- TTAGAGATGCTGTGTCCC -3'
(R):5'- GCTTTTAGACTTGGACAGAAAGAC -3'

Posted On

2019-05-13