Incidental Mutation 'R7022:Npbwr1'
ID545663
Institutional Source Beutler Lab
Gene Symbol Npbwr1
Ensembl Gene ENSMUSG00000033774
Gene Nameneuropeptides B/W receptor 1
SynonymsGpr7
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7022 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location5913707-5917398 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 5917100 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 65 (L65Q)
Ref Sequence ENSEMBL: ENSMUSP00000046233 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044180]
Predicted Effect probably damaging
Transcript: ENSMUST00000044180
AA Change: L65Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046233
Gene: ENSMUSG00000033774
AA Change: L65Q

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srw 44 327 1.3e-7 PFAM
Pfam:7TM_GPCR_Srsx 50 324 8.5e-10 PFAM
Pfam:7tm_1 56 309 1e-48 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (75/75)
MGI Phenotype PHENOTYPE: Homozygous null males develop adult-onset obesity, are hyperphagic, and have decreased energy expenditure and locomotor activity. Plasma levels of glucose, leptin and insulin are elevated in males. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A T 11: 110,083,500 S203T probably damaging Het
Adat1 A T 8: 111,989,862 M76K probably damaging Het
Ankrd33 G C 15: 101,116,899 V56L probably benign Het
Ascc3 T A 10: 50,716,629 L1134I possibly damaging Het
C3 T G 17: 57,217,286 D948A probably damaging Het
Ccdc40 A G 11: 119,231,786 E138G possibly damaging Het
Cd80 A G 16: 38,486,504 probably null Het
Cdca7 T A 2: 72,479,529 probably null Het
Chit1 A G 1: 134,151,292 S447G probably benign Het
Cmya5 C T 13: 93,069,278 probably null Het
Cnnm2 T A 19: 46,858,940 probably null Het
Cnnm2 A T 19: 46,762,550 I260F probably damaging Het
Col1a2 T C 6: 4,534,639 L881P unknown Het
Crebbp A T 16: 4,117,323 S901T probably damaging Het
Dcun1d2 T C 8: 13,271,637 Y158C probably damaging Het
Dnhd1 C T 7: 105,720,798 P4477S probably benign Het
Donson A G 16: 91,681,330 Y428H probably damaging Het
Dsp G T 13: 38,191,740 W1167L probably benign Het
Elmo2 C T 2: 165,295,041 V592M probably damaging Het
Enpp3 T A 10: 24,826,195 E60D probably damaging Het
Fam83b TAAGA T 9: 76,502,112 probably null Het
Fbxo38 A G 18: 62,536,224 C52R probably damaging Het
Gm10912 T C 2: 104,066,710 W65R probably damaging Het
Gm43518 A T 5: 123,936,427 M44L probably benign Het
Gm4881 A T 7: 24,931,664 probably null Het
Gm6583 A C 5: 112,355,529 M103R probably benign Het
Gnb1 T A 4: 155,553,456 D212E probably damaging Het
Gnl1 A G 17: 35,988,728 N597S probably damaging Het
Gprin1 T G 13: 54,739,042 E473A probably benign Het
Ighv1-69 T A 12: 115,623,214 M100L probably benign Het
Igkv14-100 T C 6: 68,519,209 S29P probably damaging Het
Ints6 A G 14: 62,714,337 V232A probably damaging Het
Jup A G 11: 100,379,553 L376P probably damaging Het
Kdr A T 5: 75,972,260 Y119* probably null Het
Kif1a T G 1: 93,066,098 T377P probably benign Het
Lama5 C A 2: 180,180,731 V2850L probably damaging Het
Lrp2 T C 2: 69,483,208 Y2393C probably damaging Het
Mfsd13a C T 19: 46,368,324 Q255* probably null Het
Msh3 A C 13: 92,235,588 D891E probably damaging Het
Msl2 A G 9: 101,075,282 N2D possibly damaging Het
Myo19 T C 11: 84,900,547 L476P probably damaging Het
Nbeal2 G A 9: 110,638,618 R501W probably damaging Het
Nfasc C A 1: 132,621,049 K293N probably damaging Het
Nrbp1 T A 5: 31,244,481 D34E probably damaging Het
Nup205 T A 6: 35,243,936 V1891D probably benign Het
Olfr172 T C 16: 58,761,119 N19S probably benign Het
Olfr577 T A 7: 102,973,968 N8I possibly damaging Het
Olfr936 G T 9: 39,047,083 C156* probably null Het
Olfr998 T A 2: 85,590,598 D19E probably benign Het
Oscp1 G A 4: 126,082,990 probably null Het
Pcdhgb7 A G 18: 37,753,033 T419A probably damaging Het
Pdzph1 T C 17: 58,974,126 D387G probably benign Het
Phc1 A G 6: 122,335,031 F56S probably damaging Het
Pik3c2g A G 6: 139,622,063 E59G possibly damaging Het
Prickle1 G T 15: 93,500,871 T692K possibly damaging Het
Rbm45 T A 2: 76,376,394 L250Q probably damaging Het
Ror1 T A 4: 100,407,911 M194K probably damaging Het
Rrbp1 T A 2: 143,957,802 probably null Het
Rundc3b T C 5: 8,512,348 K340R probably null Het
Scn1a T A 2: 66,317,899 T1101S probably damaging Het
Sdk1 C G 5: 142,094,657 probably null Het
Skiv2l A G 17: 34,845,207 F501S possibly damaging Het
Slc20a1 T A 2: 129,200,059 M114K probably damaging Het
Sorl1 A C 9: 41,969,751 I2158S probably benign Het
Strip1 A T 3: 107,626,795 F174L probably benign Het
Sucnr1 A T 3: 60,086,278 I76L probably benign Het
Syt17 C T 7: 118,408,019 V412I probably benign Het
Tie1 T A 4: 118,489,653 H18L probably benign Het
Tpp1 T G 7: 105,748,922 K345Q probably damaging Het
Trcg1 G A 9: 57,241,569 M141I possibly damaging Het
Trpc4ap T C 2: 155,657,822 N260S probably benign Het
Vps41 C A 13: 18,842,268 T512K possibly damaging Het
Vps52 A T 17: 33,959,319 M147L probably benign Het
Ywhaq A G 12: 21,391,751 probably benign Het
Zfp619 A G 7: 39,534,963 N139S probably benign Het
Other mutations in Npbwr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02282:Npbwr1 APN 1 5916965 missense possibly damaging 0.55
R0140:Npbwr1 UTSW 1 5916621 missense probably damaging 1.00
R0585:Npbwr1 UTSW 1 5916458 missense possibly damaging 0.72
R0827:Npbwr1 UTSW 1 5916789 missense possibly damaging 0.85
R1472:Npbwr1 UTSW 1 5916681 missense probably damaging 1.00
R1646:Npbwr1 UTSW 1 5917254 missense probably benign 0.01
R2001:Npbwr1 UTSW 1 5917175 missense possibly damaging 0.81
R2004:Npbwr1 UTSW 1 5916351 missense probably damaging 1.00
R2005:Npbwr1 UTSW 1 5916351 missense probably damaging 1.00
R2006:Npbwr1 UTSW 1 5916351 missense probably damaging 1.00
R2259:Npbwr1 UTSW 1 5916658 missense probably damaging 1.00
R4172:Npbwr1 UTSW 1 5916936 missense probably damaging 1.00
R5614:Npbwr1 UTSW 1 5916811 missense probably damaging 1.00
R6379:Npbwr1 UTSW 1 5917219 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TTGTACTGGTCGACGGCTAC -3'
(R):5'- GCATAAACCTCGAGTTTCGC -3'

Sequencing Primer
(F):5'- CGGCTACAATGAGCTTGCACATG -3'
(R):5'- AACTTAACGCTTTTCGAGTCTGGAG -3'
Posted On2019-05-13