Incidental Mutation 'R7022:Nfasc'
ID545665
Institutional Source Beutler Lab
Gene Symbol Nfasc
Ensembl Gene ENSMUSG00000026442
Gene Nameneurofascin
SynonymsD430023G06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7022 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location132564690-132741797 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 132621049 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 293 (K293N)
Ref Sequence ENSEMBL: ENSMUSP00000139955 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043189] [ENSMUST00000094569] [ENSMUST00000163770] [ENSMUST00000187861] [ENSMUST00000188307]
Predicted Effect probably damaging
Transcript: ENSMUST00000043189
AA Change: K287N

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000035454
Gene: ENSMUSG00000026442
AA Change: K287N

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 42 131 4.5e0 SMART
IG 141 228 2.44e-7 SMART
IGc2 253 317 1.53e-17 SMART
IGc2 343 409 1.76e-8 SMART
IGc2 437 502 2.39e-10 SMART
IGc2 528 593 2.54e-5 SMART
FN3 607 690 2.17e-11 SMART
FN3 707 789 2.85e-6 SMART
FN3 805 896 2.21e-3 SMART
FN3 911 995 9.92e-6 SMART
low complexity region 996 1018 N/A INTRINSIC
transmembrane domain 1026 1048 N/A INTRINSIC
Pfam:Bravo_FIGEY 1049 1133 1.4e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000094569
AA Change: K293N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000092148
Gene: ENSMUSG00000026442
AA Change: K293N

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 48 137 4.5e0 SMART
IG 147 234 2.44e-7 SMART
IGc2 259 323 1.53e-17 SMART
IGc2 349 415 1.76e-8 SMART
IGc2 443 508 2.39e-10 SMART
IGc2 534 599 2.54e-5 SMART
FN3 628 711 2.17e-11 SMART
FN3 728 810 2.85e-6 SMART
FN3 825 909 9.92e-6 SMART
FN3 1010 1086 6.91e-5 SMART
transmembrane domain 1109 1131 N/A INTRINSIC
Pfam:Bravo_FIGEY 1132 1216 2.2e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000163770
AA Change: K304N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132979
Gene: ENSMUSG00000026442
AA Change: K304N

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 42 131 4.5e0 SMART
IG 141 228 2.44e-7 SMART
IGc2 270 334 1.53e-17 SMART
IGc2 360 426 1.76e-8 SMART
IGc2 454 519 2.39e-10 SMART
IGc2 545 610 2.54e-5 SMART
FN3 624 707 2.17e-11 SMART
FN3 724 806 2.85e-6 SMART
FN3 822 913 2.21e-3 SMART
FN3 928 1012 9.92e-6 SMART
low complexity region 1013 1035 N/A INTRINSIC
transmembrane domain 1043 1065 N/A INTRINSIC
Pfam:Bravo_FIGEY 1066 1150 5e-30 PFAM
Predicted Effect
Predicted Effect probably damaging
Transcript: ENSMUST00000187861
AA Change: K293N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139955
Gene: ENSMUSG00000026442
AA Change: K293N

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 48 137 1.8e-2 SMART
IG 147 234 1e-9 SMART
IGc2 259 323 6.4e-20 SMART
IGc2 349 415 7e-11 SMART
IGc2 443 508 9.7e-13 SMART
IGc2 534 599 1.1e-7 SMART
FN3 628 711 1e-13 SMART
FN3 728 810 1.4e-8 SMART
FN3 826 917 1.1e-5 SMART
FN3 932 1016 4.8e-8 SMART
FN3 1117 1193 3.4e-7 SMART
transmembrane domain 1216 1238 N/A INTRINSIC
Pfam:Bravo_FIGEY 1239 1325 2.6e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000188307
AA Change: K287N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139520
Gene: ENSMUSG00000026442
AA Change: K287N

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 42 131 1.8e-2 SMART
IG 141 228 1e-9 SMART
IGc2 253 317 6.4e-20 SMART
IGc2 343 409 7e-11 SMART
IGc2 437 502 9.7e-13 SMART
IGc2 528 593 1.1e-7 SMART
FN3 622 705 1e-13 SMART
FN3 722 804 1.4e-8 SMART
FN3 820 890 3.8e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: This gene encodes an L1 family immunoglobulin cell adhesion molecule with multiple IGcam and fibronectin domains. The protein functions in neurite outgrowth, neurite fasciculation, and organization of the axon initial segment (AIS) and nodes of Ranvier on axons during early development. Both the AIS and nodes of Ranvier contain high densities of voltage-gated Na+ (Nav) channels which are clustered by interactions with cytoskeletal and scaffolding proteins including this protein, gliomedin, ankyrin 3 (ankyrin-G), and betaIV spectrin. This protein links the AIS extracellular matrix to the intracellular cytoskeleton. This gene undergoes extensive alternative splicing, and the full-length nature of some variants has not been determined. [provided by RefSeq, May 2009]
PHENOTYPE: Mice homozygous for a null allele die within 6 to 7 days of birth, exhibit reduced nerve conduction velocity and abnormal paranodal junction formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A T 11: 110,083,500 S203T probably damaging Het
Adat1 A T 8: 111,989,862 M76K probably damaging Het
Ankrd33 G C 15: 101,116,899 V56L probably benign Het
Ascc3 T A 10: 50,716,629 L1134I possibly damaging Het
C3 T G 17: 57,217,286 D948A probably damaging Het
Ccdc40 A G 11: 119,231,786 E138G possibly damaging Het
Cd80 A G 16: 38,486,504 probably null Het
Cdca7 T A 2: 72,479,529 probably null Het
Chit1 A G 1: 134,151,292 S447G probably benign Het
Cmya5 C T 13: 93,069,278 probably null Het
Cnnm2 T A 19: 46,858,940 probably null Het
Cnnm2 A T 19: 46,762,550 I260F probably damaging Het
Col1a2 T C 6: 4,534,639 L881P unknown Het
Crebbp A T 16: 4,117,323 S901T probably damaging Het
Dcun1d2 T C 8: 13,271,637 Y158C probably damaging Het
Dnhd1 C T 7: 105,720,798 P4477S probably benign Het
Donson A G 16: 91,681,330 Y428H probably damaging Het
Dsp G T 13: 38,191,740 W1167L probably benign Het
Elmo2 C T 2: 165,295,041 V592M probably damaging Het
Enpp3 T A 10: 24,826,195 E60D probably damaging Het
Fam83b TAAGA T 9: 76,502,112 probably null Het
Fbxo38 A G 18: 62,536,224 C52R probably damaging Het
Gm10912 T C 2: 104,066,710 W65R probably damaging Het
Gm43518 A T 5: 123,936,427 M44L probably benign Het
Gm4881 A T 7: 24,931,664 probably null Het
Gm6583 A C 5: 112,355,529 M103R probably benign Het
Gnb1 T A 4: 155,553,456 D212E probably damaging Het
Gnl1 A G 17: 35,988,728 N597S probably damaging Het
Gprin1 T G 13: 54,739,042 E473A probably benign Het
Ighv1-69 T A 12: 115,623,214 M100L probably benign Het
Igkv14-100 T C 6: 68,519,209 S29P probably damaging Het
Ints6 A G 14: 62,714,337 V232A probably damaging Het
Jup A G 11: 100,379,553 L376P probably damaging Het
Kdr A T 5: 75,972,260 Y119* probably null Het
Kif1a T G 1: 93,066,098 T377P probably benign Het
Lama5 C A 2: 180,180,731 V2850L probably damaging Het
Lrp2 T C 2: 69,483,208 Y2393C probably damaging Het
Mfsd13a C T 19: 46,368,324 Q255* probably null Het
Msh3 A C 13: 92,235,588 D891E probably damaging Het
Msl2 A G 9: 101,075,282 N2D possibly damaging Het
Myo19 T C 11: 84,900,547 L476P probably damaging Het
Nbeal2 G A 9: 110,638,618 R501W probably damaging Het
Npbwr1 A T 1: 5,917,100 L65Q probably damaging Het
Nrbp1 T A 5: 31,244,481 D34E probably damaging Het
Nup205 T A 6: 35,243,936 V1891D probably benign Het
Olfr172 T C 16: 58,761,119 N19S probably benign Het
Olfr577 T A 7: 102,973,968 N8I possibly damaging Het
Olfr936 G T 9: 39,047,083 C156* probably null Het
Olfr998 T A 2: 85,590,598 D19E probably benign Het
Oscp1 G A 4: 126,082,990 probably null Het
Pcdhgb7 A G 18: 37,753,033 T419A probably damaging Het
Pdzph1 T C 17: 58,974,126 D387G probably benign Het
Phc1 A G 6: 122,335,031 F56S probably damaging Het
Pik3c2g A G 6: 139,622,063 E59G possibly damaging Het
Prickle1 G T 15: 93,500,871 T692K possibly damaging Het
Rbm45 T A 2: 76,376,394 L250Q probably damaging Het
Ror1 T A 4: 100,407,911 M194K probably damaging Het
Rrbp1 T A 2: 143,957,802 probably null Het
Rundc3b T C 5: 8,512,348 K340R probably null Het
Scn1a T A 2: 66,317,899 T1101S probably damaging Het
Sdk1 C G 5: 142,094,657 probably null Het
Skiv2l A G 17: 34,845,207 F501S possibly damaging Het
Slc20a1 T A 2: 129,200,059 M114K probably damaging Het
Sorl1 A C 9: 41,969,751 I2158S probably benign Het
Strip1 A T 3: 107,626,795 F174L probably benign Het
Sucnr1 A T 3: 60,086,278 I76L probably benign Het
Syt17 C T 7: 118,408,019 V412I probably benign Het
Tie1 T A 4: 118,489,653 H18L probably benign Het
Tpp1 T G 7: 105,748,922 K345Q probably damaging Het
Trcg1 G A 9: 57,241,569 M141I possibly damaging Het
Trpc4ap T C 2: 155,657,822 N260S probably benign Het
Vps41 C A 13: 18,842,268 T512K possibly damaging Het
Vps52 A T 17: 33,959,319 M147L probably benign Het
Ywhaq A G 12: 21,391,751 probably benign Het
Zfp619 A G 7: 39,534,963 N139S probably benign Het
Other mutations in Nfasc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00895:Nfasc APN 1 132573798 nonsense probably null
IGL01088:Nfasc APN 1 132642776 utr 5 prime probably benign
IGL01958:Nfasc APN 1 132608438 nonsense probably null
IGL01999:Nfasc APN 1 132605247 splice site probably benign
IGL02170:Nfasc APN 1 132610366 nonsense probably null
IGL02187:Nfasc APN 1 132570481 missense probably damaging 1.00
IGL02192:Nfasc APN 1 132570481 missense probably damaging 1.00
IGL02452:Nfasc APN 1 132620924 critical splice donor site probably null
IGL02698:Nfasc APN 1 132634737 missense probably benign 0.06
IGL02797:Nfasc APN 1 132610448 missense probably damaging 1.00
IGL03000:Nfasc APN 1 132621509 splice site probably benign
IGL03027:Nfasc APN 1 132610469 missense probably damaging 1.00
jiggle UTSW 1 132602021 missense probably damaging 1.00
tremble UTSW 1 132611595 missense probably damaging 1.00
PIT4377001:Nfasc UTSW 1 132583066 missense unknown
R0240:Nfasc UTSW 1 132601983 missense probably damaging 1.00
R0240:Nfasc UTSW 1 132601983 missense probably damaging 1.00
R0241:Nfasc UTSW 1 132636993 missense probably benign 0.02
R0241:Nfasc UTSW 1 132636993 missense probably benign 0.02
R0418:Nfasc UTSW 1 132611595 missense probably damaging 1.00
R0513:Nfasc UTSW 1 132603846 missense possibly damaging 0.95
R0639:Nfasc UTSW 1 132603816 missense probably damaging 1.00
R0646:Nfasc UTSW 1 132608438 nonsense probably null
R1103:Nfasc UTSW 1 132607057 splice site probably benign
R1269:Nfasc UTSW 1 132610788 missense probably damaging 1.00
R1550:Nfasc UTSW 1 132608503 missense probably damaging 0.96
R1749:Nfasc UTSW 1 132611632 missense probably damaging 1.00
R1773:Nfasc UTSW 1 132610839 missense probably damaging 1.00
R1921:Nfasc UTSW 1 132610805 missense probably damaging 1.00
R1987:Nfasc UTSW 1 132610886 missense probably damaging 1.00
R2141:Nfasc UTSW 1 132596645 missense probably damaging 1.00
R2239:Nfasc UTSW 1 132583022 intron probably benign
R2413:Nfasc UTSW 1 132595505 missense probably damaging 1.00
R2428:Nfasc UTSW 1 132595654 missense possibly damaging 0.55
R2472:Nfasc UTSW 1 132588221 intron probably benign
R2517:Nfasc UTSW 1 132597763 unclassified probably null
R3850:Nfasc UTSW 1 132631733 missense probably damaging 1.00
R4050:Nfasc UTSW 1 132610305 splice site probably benign
R4061:Nfasc UTSW 1 132597845 missense probably damaging 1.00
R4088:Nfasc UTSW 1 132595591 missense probably damaging 1.00
R4342:Nfasc UTSW 1 132631705 missense probably damaging 1.00
R4343:Nfasc UTSW 1 132631705 missense probably damaging 1.00
R4345:Nfasc UTSW 1 132631705 missense probably damaging 1.00
R4452:Nfasc UTSW 1 132634671 missense probably damaging 1.00
R4818:Nfasc UTSW 1 132603830 missense possibly damaging 0.87
R4851:Nfasc UTSW 1 132602021 missense probably damaging 1.00
R5014:Nfasc UTSW 1 132584447 intron probably benign
R5768:Nfasc UTSW 1 132605145 missense probably benign 0.00
R6145:Nfasc UTSW 1 132634717 missense probably damaging 1.00
R6335:Nfasc UTSW 1 132576394 missense probably damaging 0.98
R6379:Nfasc UTSW 1 132570542 nonsense probably null
R6486:Nfasc UTSW 1 132605214 missense probably damaging 1.00
R7062:Nfasc UTSW 1 132601969 critical splice donor site probably null
R7084:Nfasc UTSW 1 132570509 missense unknown
R7275:Nfasc UTSW 1 132634263 missense probably damaging 1.00
R7286:Nfasc UTSW 1 132602052 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTTTCCCAGCCATAGCAGG -3'
(R):5'- TAGGAGAGCCCAGGTTCTAG -3'

Sequencing Primer
(F):5'- AGGGGCGTCATGACATTG -3'
(R):5'- GCCCAGGTTCTAGAGGGTATATAC -3'
Posted On2019-05-13