Incidental Mutation 'R7022:Olfr998'
ID545670
Institutional Source Beutler Lab
Gene Symbol Olfr998
Ensembl Gene ENSMUSG00000111454
Gene Nameolfactory receptor 998
SynonymsGA_x6K02T2Q125-47069356-47070300, MOR175-5
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.324) question?
Stock #R7022 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location85588948-85591893 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 85590598 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 19 (D19E)
Ref Sequence ENSEMBL: ENSMUSP00000150713 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052307] [ENSMUST00000215083]
Predicted Effect probably benign
Transcript: ENSMUST00000052307
AA Change: D19E

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000059970
Gene: ENSMUSG00000111454
AA Change: D19E

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.6e-54 PFAM
Pfam:7tm_1 41 308 9.5e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215083
AA Change: D19E

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A T 11: 110,083,500 S203T probably damaging Het
Adat1 A T 8: 111,989,862 M76K probably damaging Het
Ankrd33 G C 15: 101,116,899 V56L probably benign Het
Ascc3 T A 10: 50,716,629 L1134I possibly damaging Het
C3 T G 17: 57,217,286 D948A probably damaging Het
Ccdc40 A G 11: 119,231,786 E138G possibly damaging Het
Cd80 A G 16: 38,486,504 probably null Het
Cdca7 T A 2: 72,479,529 probably null Het
Chit1 A G 1: 134,151,292 S447G probably benign Het
Cmya5 C T 13: 93,069,278 probably null Het
Cnnm2 T A 19: 46,858,940 probably null Het
Cnnm2 A T 19: 46,762,550 I260F probably damaging Het
Col1a2 T C 6: 4,534,639 L881P unknown Het
Crebbp A T 16: 4,117,323 S901T probably damaging Het
Dcun1d2 T C 8: 13,271,637 Y158C probably damaging Het
Dnhd1 C T 7: 105,720,798 P4477S probably benign Het
Donson A G 16: 91,681,330 Y428H probably damaging Het
Dsp G T 13: 38,191,740 W1167L probably benign Het
Elmo2 C T 2: 165,295,041 V592M probably damaging Het
Enpp3 T A 10: 24,826,195 E60D probably damaging Het
Fam83b TAAGA T 9: 76,502,112 probably null Het
Fbxo38 A G 18: 62,536,224 C52R probably damaging Het
Gm10912 T C 2: 104,066,710 W65R probably damaging Het
Gm43518 A T 5: 123,936,427 M44L probably benign Het
Gm4881 A T 7: 24,931,664 probably null Het
Gm6583 A C 5: 112,355,529 M103R probably benign Het
Gnb1 T A 4: 155,553,456 D212E probably damaging Het
Gnl1 A G 17: 35,988,728 N597S probably damaging Het
Gprin1 T G 13: 54,739,042 E473A probably benign Het
Ighv1-69 T A 12: 115,623,214 M100L probably benign Het
Igkv14-100 T C 6: 68,519,209 S29P probably damaging Het
Ints6 A G 14: 62,714,337 V232A probably damaging Het
Jup A G 11: 100,379,553 L376P probably damaging Het
Kdr A T 5: 75,972,260 Y119* probably null Het
Kif1a T G 1: 93,066,098 T377P probably benign Het
Lama5 C A 2: 180,180,731 V2850L probably damaging Het
Lrp2 T C 2: 69,483,208 Y2393C probably damaging Het
Mfsd13a C T 19: 46,368,324 Q255* probably null Het
Msh3 A C 13: 92,235,588 D891E probably damaging Het
Msl2 A G 9: 101,075,282 N2D possibly damaging Het
Myo19 T C 11: 84,900,547 L476P probably damaging Het
Nbeal2 G A 9: 110,638,618 R501W probably damaging Het
Nfasc C A 1: 132,621,049 K293N probably damaging Het
Npbwr1 A T 1: 5,917,100 L65Q probably damaging Het
Nrbp1 T A 5: 31,244,481 D34E probably damaging Het
Nup205 T A 6: 35,243,936 V1891D probably benign Het
Olfr172 T C 16: 58,761,119 N19S probably benign Het
Olfr577 T A 7: 102,973,968 N8I possibly damaging Het
Olfr936 G T 9: 39,047,083 C156* probably null Het
Oscp1 G A 4: 126,082,990 probably null Het
Pcdhgb7 A G 18: 37,753,033 T419A probably damaging Het
Pdzph1 T C 17: 58,974,126 D387G probably benign Het
Phc1 A G 6: 122,335,031 F56S probably damaging Het
Pik3c2g A G 6: 139,622,063 E59G possibly damaging Het
Prickle1 G T 15: 93,500,871 T692K possibly damaging Het
Rbm45 T A 2: 76,376,394 L250Q probably damaging Het
Ror1 T A 4: 100,407,911 M194K probably damaging Het
Rrbp1 T A 2: 143,957,802 probably null Het
Rundc3b T C 5: 8,512,348 K340R probably null Het
Scn1a T A 2: 66,317,899 T1101S probably damaging Het
Sdk1 C G 5: 142,094,657 probably null Het
Skiv2l A G 17: 34,845,207 F501S possibly damaging Het
Slc20a1 T A 2: 129,200,059 M114K probably damaging Het
Sorl1 A C 9: 41,969,751 I2158S probably benign Het
Strip1 A T 3: 107,626,795 F174L probably benign Het
Sucnr1 A T 3: 60,086,278 I76L probably benign Het
Syt17 C T 7: 118,408,019 V412I probably benign Het
Tie1 T A 4: 118,489,653 H18L probably benign Het
Tpp1 T G 7: 105,748,922 K345Q probably damaging Het
Trcg1 G A 9: 57,241,569 M141I possibly damaging Het
Trpc4ap T C 2: 155,657,822 N260S probably benign Het
Vps41 C A 13: 18,842,268 T512K possibly damaging Het
Vps52 A T 17: 33,959,319 M147L probably benign Het
Ywhaq A G 12: 21,391,751 probably benign Het
Zfp619 A G 7: 39,534,963 N139S probably benign Het
Other mutations in Olfr998
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01763:Olfr998 APN 2 85591347 missense probably benign 0.00
R0091:Olfr998 UTSW 2 85591352 missense probably benign 0.38
R0241:Olfr998 UTSW 2 85590810 missense probably benign 0.20
R0241:Olfr998 UTSW 2 85590810 missense probably benign 0.20
R0268:Olfr998 UTSW 2 85591301 missense possibly damaging 0.78
R0481:Olfr998 UTSW 2 85591104 missense possibly damaging 0.94
R1816:Olfr998 UTSW 2 85590925 missense probably benign 0.00
R1988:Olfr998 UTSW 2 85590641 missense probably benign 0.00
R2008:Olfr998 UTSW 2 85591422 missense probably damaging 1.00
R2060:Olfr998 UTSW 2 85591283 missense possibly damaging 0.78
R2273:Olfr998 UTSW 2 85590588 missense probably damaging 1.00
R4409:Olfr998 UTSW 2 85590930 missense probably damaging 1.00
R4783:Olfr998 UTSW 2 85590938 missense probably benign 0.03
R4785:Olfr998 UTSW 2 85590938 missense probably benign 0.03
R5098:Olfr998 UTSW 2 85590632 missense probably benign 0.00
R5176:Olfr998 UTSW 2 85591435 missense possibly damaging 0.88
R5462:Olfr998 UTSW 2 85591296 missense probably damaging 1.00
R6092:Olfr998 UTSW 2 85590606 missense probably benign 0.14
R6278:Olfr998 UTSW 2 85590998 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCTTTGTGGGGAGAGTCACC -3'
(R):5'- ACAGAGCATCTTAGGAGCTATGG -3'

Sequencing Primer
(F):5'- GACCCTGTACCCAAGATTATACATG -3'
(R):5'- GCATCTTAGGAGCTATGGAAGAAG -3'
Posted On2019-05-13