Incidental Mutation 'R7022:Elmo2'
ID545674
Institutional Source Beutler Lab
Gene Symbol Elmo2
Ensembl Gene ENSMUSG00000017670
Gene Nameengulfment and cell motility 2
SynonymsCED-12, 1190002F24Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.431) question?
Stock #R7022 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location165288031-165326479 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 165295041 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 592 (V592M)
Ref Sequence ENSEMBL: ENSMUSP00000099377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071699] [ENSMUST00000074046] [ENSMUST00000094329] [ENSMUST00000103088] [ENSMUST00000103091]
Predicted Effect probably damaging
Transcript: ENSMUST00000071699
AA Change: V592M

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000071619
Gene: ENSMUSG00000017670
AA Change: V592M

DomainStartEndE-ValueType
Pfam:DUF3361 115 272 1.6e-61 PFAM
Pfam:ELMO_CED12 295 474 3.2e-39 PFAM
Pfam:PH_12 541 657 5.4e-33 PFAM
internal_repeat_1 670 688 6.69e-7 PROSPERO
Predicted Effect possibly damaging
Transcript: ENSMUST00000074046
AA Change: V604M

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000073691
Gene: ENSMUSG00000017670
AA Change: V604M

DomainStartEndE-ValueType
Pfam:DUF3361 114 285 2.7e-75 PFAM
Pfam:ELMO_CED12 304 487 3.7e-48 PFAM
PDB:3A98|D 535 729 3e-99 PDB
SCOP:d1mai__ 552 677 4e-33 SMART
Blast:PH 560 681 2e-82 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000094329
AA Change: V592M

PolyPhen 2 Score 0.568 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000091887
Gene: ENSMUSG00000017670
AA Change: V592M

DomainStartEndE-ValueType
Pfam:DUF3361 114 273 5.6e-77 PFAM
Pfam:ELMO_CED12 292 475 3.6e-48 PFAM
PDB:3A98|D 523 717 2e-99 PDB
SCOP:d1mai__ 540 665 5e-33 SMART
Blast:PH 548 669 1e-82 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000103088
AA Change: V592M

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099377
Gene: ENSMUSG00000017670
AA Change: V592M

DomainStartEndE-ValueType
Pfam:DUF3361 114 273 6.6e-77 PFAM
Pfam:ELMO_CED12 292 475 4.3e-48 PFAM
internal_repeat_1 654 672 6.69e-7 PROSPERO
internal_repeat_1 670 688 6.69e-7 PROSPERO
Predicted Effect possibly damaging
Transcript: ENSMUST00000103091
AA Change: V592M

PolyPhen 2 Score 0.568 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000099380
Gene: ENSMUSG00000017670
AA Change: V592M

DomainStartEndE-ValueType
Pfam:DUF3361 114 273 5.6e-77 PFAM
Pfam:ELMO_CED12 292 475 3.6e-48 PFAM
PDB:3A98|D 523 717 2e-99 PDB
SCOP:d1mai__ 540 665 5e-33 SMART
Blast:PH 548 669 1e-82 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000137188
SMART Domains Protein: ENSMUSP00000123232
Gene: ENSMUSG00000017670

DomainStartEndE-ValueType
Pfam:DUF3361 17 172 1.6e-64 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000117124
Gene: ENSMUSG00000017670
AA Change: V165M

DomainStartEndE-ValueType
Pfam:ELMO_CED12 2 48 9.6e-10 PFAM
Pfam:PH_12 115 237 1.3e-35 PFAM
low complexity region 270 280 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene interacts with the dedicator of cyto-kinesis 1 protein. Similarity to a C. elegans protein suggests that this protein may function in phagocytosis of apoptotic cells and in cell migration. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A T 11: 110,083,500 S203T probably damaging Het
Adat1 A T 8: 111,989,862 M76K probably damaging Het
Ankrd33 G C 15: 101,116,899 V56L probably benign Het
Ascc3 T A 10: 50,716,629 L1134I possibly damaging Het
C3 T G 17: 57,217,286 D948A probably damaging Het
Ccdc40 A G 11: 119,231,786 E138G possibly damaging Het
Cd80 A G 16: 38,486,504 probably null Het
Cdca7 T A 2: 72,479,529 probably null Het
Chit1 A G 1: 134,151,292 S447G probably benign Het
Cmya5 C T 13: 93,069,278 probably null Het
Cnnm2 A T 19: 46,762,550 I260F probably damaging Het
Cnnm2 T A 19: 46,858,940 probably null Het
Col1a2 T C 6: 4,534,639 L881P unknown Het
Crebbp A T 16: 4,117,323 S901T probably damaging Het
Dcun1d2 T C 8: 13,271,637 Y158C probably damaging Het
Dnhd1 C T 7: 105,720,798 P4477S probably benign Het
Donson A G 16: 91,681,330 Y428H probably damaging Het
Dsp G T 13: 38,191,740 W1167L probably benign Het
Enpp3 T A 10: 24,826,195 E60D probably damaging Het
Fam83b TAAGA T 9: 76,502,112 probably null Het
Fbxo38 A G 18: 62,536,224 C52R probably damaging Het
Gm10912 T C 2: 104,066,710 W65R probably damaging Het
Gm43518 A T 5: 123,936,427 M44L probably benign Het
Gm4881 A T 7: 24,931,664 probably null Het
Gm6583 A C 5: 112,355,529 M103R probably benign Het
Gnb1 T A 4: 155,553,456 D212E probably damaging Het
Gnl1 A G 17: 35,988,728 N597S probably damaging Het
Gprin1 T G 13: 54,739,042 E473A probably benign Het
Ighv1-69 T A 12: 115,623,214 M100L probably benign Het
Igkv14-100 T C 6: 68,519,209 S29P probably damaging Het
Ints6 A G 14: 62,714,337 V232A probably damaging Het
Jup A G 11: 100,379,553 L376P probably damaging Het
Kdr A T 5: 75,972,260 Y119* probably null Het
Kif1a T G 1: 93,066,098 T377P probably benign Het
Lama5 C A 2: 180,180,731 V2850L probably damaging Het
Lrp2 T C 2: 69,483,208 Y2393C probably damaging Het
Mfsd13a C T 19: 46,368,324 Q255* probably null Het
Msh3 A C 13: 92,235,588 D891E probably damaging Het
Msl2 A G 9: 101,075,282 N2D possibly damaging Het
Myo19 T C 11: 84,900,547 L476P probably damaging Het
Nbeal2 G A 9: 110,638,618 R501W probably damaging Het
Nfasc C A 1: 132,621,049 K293N probably damaging Het
Npbwr1 A T 1: 5,917,100 L65Q probably damaging Het
Nrbp1 T A 5: 31,244,481 D34E probably damaging Het
Nup205 T A 6: 35,243,936 V1891D probably benign Het
Olfr172 T C 16: 58,761,119 N19S probably benign Het
Olfr577 T A 7: 102,973,968 N8I possibly damaging Het
Olfr936 G T 9: 39,047,083 C156* probably null Het
Olfr998 T A 2: 85,590,598 D19E probably benign Het
Oscp1 G A 4: 126,082,990 probably null Het
Pcdhgb7 A G 18: 37,753,033 T419A probably damaging Het
Pdzph1 T C 17: 58,974,126 D387G probably benign Het
Phc1 A G 6: 122,335,031 F56S probably damaging Het
Pik3c2g A G 6: 139,622,063 E59G possibly damaging Het
Prickle1 G T 15: 93,500,871 T692K possibly damaging Het
Rbm45 T A 2: 76,376,394 L250Q probably damaging Het
Ror1 T A 4: 100,407,911 M194K probably damaging Het
Rrbp1 T A 2: 143,957,802 probably null Het
Rundc3b T C 5: 8,512,348 K340R probably null Het
Scn1a T A 2: 66,317,899 T1101S probably damaging Het
Sdk1 C G 5: 142,094,657 probably null Het
Skiv2l A G 17: 34,845,207 F501S possibly damaging Het
Slc20a1 T A 2: 129,200,059 M114K probably damaging Het
Sorl1 A C 9: 41,969,751 I2158S probably benign Het
Strip1 A T 3: 107,626,795 F174L probably benign Het
Sucnr1 A T 3: 60,086,278 I76L probably benign Het
Syt17 C T 7: 118,408,019 V412I probably benign Het
Tie1 T A 4: 118,489,653 H18L probably benign Het
Tpp1 T G 7: 105,748,922 K345Q probably damaging Het
Trcg1 G A 9: 57,241,569 M141I possibly damaging Het
Trpc4ap T C 2: 155,657,822 N260S probably benign Het
Vps41 C A 13: 18,842,268 T512K possibly damaging Het
Vps52 A T 17: 33,959,319 M147L probably benign Het
Ywhaq A G 12: 21,391,751 probably benign Het
Zfp619 A G 7: 39,534,963 N139S probably benign Het
Other mutations in Elmo2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00796:Elmo2 APN 2 165292014 unclassified probably benign
IGL01096:Elmo2 APN 2 165296987 unclassified probably benign
IGL01694:Elmo2 APN 2 165314773 missense probably benign 0.05
IGL02016:Elmo2 APN 2 165295012 critical splice donor site probably null
IGL02402:Elmo2 APN 2 165297392 missense probably damaging 0.97
IGL02808:Elmo2 APN 2 165291707 unclassified probably benign
IGL03030:Elmo2 APN 2 165294317 missense possibly damaging 0.93
IGL03117:Elmo2 APN 2 165298653 missense probably benign 0.01
R0046:Elmo2 UTSW 2 165298726 missense probably damaging 0.97
R0046:Elmo2 UTSW 2 165298726 missense probably damaging 0.97
R0278:Elmo2 UTSW 2 165297367 missense probably damaging 1.00
R0281:Elmo2 UTSW 2 165296890 missense probably damaging 1.00
R0472:Elmo2 UTSW 2 165298330 missense probably damaging 0.99
R0570:Elmo2 UTSW 2 165304919 missense probably benign 0.38
R1799:Elmo2 UTSW 2 165292157 missense probably damaging 1.00
R1940:Elmo2 UTSW 2 165292050 unclassified probably benign
R2005:Elmo2 UTSW 2 165298279 missense probably benign 0.00
R2504:Elmo2 UTSW 2 165298687 missense probably damaging 0.96
R2915:Elmo2 UTSW 2 165297653 unclassified probably benign
R3744:Elmo2 UTSW 2 165316002 missense probably damaging 0.96
R4027:Elmo2 UTSW 2 165294249 nonsense probably null
R4419:Elmo2 UTSW 2 165311755 unclassified probably null
R4824:Elmo2 UTSW 2 165292002 unclassified probably benign
R4888:Elmo2 UTSW 2 165295289 missense probably benign 0.14
R4950:Elmo2 UTSW 2 165314813 unclassified probably null
R5157:Elmo2 UTSW 2 165291707 unclassified probably benign
R5535:Elmo2 UTSW 2 165310212 missense possibly damaging 0.51
R5682:Elmo2 UTSW 2 165297410 missense probably damaging 1.00
R5840:Elmo2 UTSW 2 165295552 missense possibly damaging 0.64
R5868:Elmo2 UTSW 2 165294272 missense possibly damaging 0.89
R7089:Elmo2 UTSW 2 165304929 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- ACTGCCACAACTGGGATTC -3'
(R):5'- CAGCAGCTTCCGGAAAATCG -3'

Sequencing Primer
(F):5'- GGGATTCAGTAACTCTCCCAC -3'
(R):5'- AGCATGGGTAGTCTGCCAG -3'
Posted On2019-05-13