Incidental Mutation 'R7022:Tie1'
ID545679
Institutional Source Beutler Lab
Gene Symbol Tie1
Ensembl Gene ENSMUSG00000033191
Gene Nametyrosine kinase with immunoglobulin-like and EGF-like domains 1
SynonymsTIE, D430008P04Rik, tie-1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7022 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location118471191-118490061 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 118489653 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 18 (H18L)
Ref Sequence ENSEMBL: ENSMUSP00000139279 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047421] [ENSMUST00000184261]
Predicted Effect probably benign
Transcript: ENSMUST00000047421
AA Change: H18L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000037129
Gene: ENSMUSG00000033191
AA Change: H18L

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
IG 129 211 1.58e-1 SMART
EGF 221 254 1.47e-3 SMART
EGF_like 265 301 7.23e1 SMART
EGF 312 343 8.52e0 SMART
IG 355 442 1.92e0 SMART
FN3 445 528 2.68e-2 SMART
FN3 544 627 4.1e0 SMART
FN3 640 722 6.95e-10 SMART
transmembrane domain 760 782 N/A INTRINSIC
TyrKc 835 1103 5.05e-134 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184261
AA Change: H18L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000139279
Gene: ENSMUSG00000033191
AA Change: H18L

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
IG 129 211 1.58e-1 SMART
EGF 221 254 1.47e-3 SMART
EGF_like 265 301 7.23e1 SMART
EGF 312 343 8.52e0 SMART
IG 355 442 1.92e0 SMART
FN3 445 528 2.68e-2 SMART
FN3 544 627 4.1e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tyrosine protein kinase family. The encoded protein plays a critical role in angiogenesis and blood vessel stability by inhibiting angiopoietin 1 signaling through the endothelial receptor tyrosine kinase Tie2. Ectodomain cleavage of the encoded protein relieves inhibition of Tie2 and is mediated by multiple factors including vascular endothelial growth factor. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Homozygous mutation of this gene results in embryonic or neonatal lethality, hemorrhages, edema, increased vascular branching, and abnormal vascular endothelial cell development. Mice homozygous for a hypomorphic allele exhibit dilated and disorganized lymphatic vessel, edema, and hemorrhage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A T 11: 110,083,500 S203T probably damaging Het
Adat1 A T 8: 111,989,862 M76K probably damaging Het
Ankrd33 G C 15: 101,116,899 V56L probably benign Het
Ascc3 T A 10: 50,716,629 L1134I possibly damaging Het
C3 T G 17: 57,217,286 D948A probably damaging Het
Ccdc40 A G 11: 119,231,786 E138G possibly damaging Het
Cd80 A G 16: 38,486,504 probably null Het
Cdca7 T A 2: 72,479,529 probably null Het
Chit1 A G 1: 134,151,292 S447G probably benign Het
Cmya5 C T 13: 93,069,278 probably null Het
Cnnm2 T A 19: 46,858,940 probably null Het
Cnnm2 A T 19: 46,762,550 I260F probably damaging Het
Col1a2 T C 6: 4,534,639 L881P unknown Het
Crebbp A T 16: 4,117,323 S901T probably damaging Het
Dcun1d2 T C 8: 13,271,637 Y158C probably damaging Het
Dnhd1 C T 7: 105,720,798 P4477S probably benign Het
Donson A G 16: 91,681,330 Y428H probably damaging Het
Dsp G T 13: 38,191,740 W1167L probably benign Het
Elmo2 C T 2: 165,295,041 V592M probably damaging Het
Enpp3 T A 10: 24,826,195 E60D probably damaging Het
Fam83b TAAGA T 9: 76,502,112 probably null Het
Fbxo38 A G 18: 62,536,224 C52R probably damaging Het
Gm10912 T C 2: 104,066,710 W65R probably damaging Het
Gm43518 A T 5: 123,936,427 M44L probably benign Het
Gm4881 A T 7: 24,931,664 probably null Het
Gm6583 A C 5: 112,355,529 M103R probably benign Het
Gnb1 T A 4: 155,553,456 D212E probably damaging Het
Gnl1 A G 17: 35,988,728 N597S probably damaging Het
Gprin1 T G 13: 54,739,042 E473A probably benign Het
Ighv1-69 T A 12: 115,623,214 M100L probably benign Het
Igkv14-100 T C 6: 68,519,209 S29P probably damaging Het
Ints6 A G 14: 62,714,337 V232A probably damaging Het
Jup A G 11: 100,379,553 L376P probably damaging Het
Kdr A T 5: 75,972,260 Y119* probably null Het
Kif1a T G 1: 93,066,098 T377P probably benign Het
Lama5 C A 2: 180,180,731 V2850L probably damaging Het
Lrp2 T C 2: 69,483,208 Y2393C probably damaging Het
Mfsd13a C T 19: 46,368,324 Q255* probably null Het
Msh3 A C 13: 92,235,588 D891E probably damaging Het
Msl2 A G 9: 101,075,282 N2D possibly damaging Het
Myo19 T C 11: 84,900,547 L476P probably damaging Het
Nbeal2 G A 9: 110,638,618 R501W probably damaging Het
Nfasc C A 1: 132,621,049 K293N probably damaging Het
Npbwr1 A T 1: 5,917,100 L65Q probably damaging Het
Nrbp1 T A 5: 31,244,481 D34E probably damaging Het
Nup205 T A 6: 35,243,936 V1891D probably benign Het
Olfr172 T C 16: 58,761,119 N19S probably benign Het
Olfr577 T A 7: 102,973,968 N8I possibly damaging Het
Olfr936 G T 9: 39,047,083 C156* probably null Het
Olfr998 T A 2: 85,590,598 D19E probably benign Het
Oscp1 G A 4: 126,082,990 probably null Het
Pcdhgb7 A G 18: 37,753,033 T419A probably damaging Het
Pdzph1 T C 17: 58,974,126 D387G probably benign Het
Phc1 A G 6: 122,335,031 F56S probably damaging Het
Pik3c2g A G 6: 139,622,063 E59G possibly damaging Het
Prickle1 G T 15: 93,500,871 T692K possibly damaging Het
Rbm45 T A 2: 76,376,394 L250Q probably damaging Het
Ror1 T A 4: 100,407,911 M194K probably damaging Het
Rrbp1 T A 2: 143,957,802 probably null Het
Rundc3b T C 5: 8,512,348 K340R probably null Het
Scn1a T A 2: 66,317,899 T1101S probably damaging Het
Sdk1 C G 5: 142,094,657 probably null Het
Skiv2l A G 17: 34,845,207 F501S possibly damaging Het
Slc20a1 T A 2: 129,200,059 M114K probably damaging Het
Sorl1 A C 9: 41,969,751 I2158S probably benign Het
Strip1 A T 3: 107,626,795 F174L probably benign Het
Sucnr1 A T 3: 60,086,278 I76L probably benign Het
Syt17 C T 7: 118,408,019 V412I probably benign Het
Tpp1 T G 7: 105,748,922 K345Q probably damaging Het
Trcg1 G A 9: 57,241,569 M141I possibly damaging Het
Trpc4ap T C 2: 155,657,822 N260S probably benign Het
Vps41 C A 13: 18,842,268 T512K possibly damaging Het
Vps52 A T 17: 33,959,319 M147L probably benign Het
Ywhaq A G 12: 21,391,751 probably benign Het
Zfp619 A G 7: 39,534,963 N139S probably benign Het
Other mutations in Tie1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01419:Tie1 APN 4 118476098 missense probably damaging 1.00
IGL01679:Tie1 APN 4 118482739 missense probably benign 0.00
IGL01821:Tie1 APN 4 118484638 missense probably damaging 0.99
IGL01892:Tie1 APN 4 118475918 missense probably benign
IGL02101:Tie1 APN 4 118472798 missense probably benign 0.42
IGL02411:Tie1 APN 4 118486563 nonsense probably null
IGL02421:Tie1 APN 4 118486394 missense probably damaging 1.00
IGL02892:Tie1 APN 4 118486282 missense probably damaging 1.00
IGL03294:Tie1 APN 4 118480223 missense probably damaging 1.00
IGL03346:Tie1 APN 4 118472828 missense probably damaging 1.00
R0064:Tie1 UTSW 4 118489701 missense possibly damaging 0.94
R0067:Tie1 UTSW 4 118476280 splice site probably benign
R0080:Tie1 UTSW 4 118484353 missense probably damaging 1.00
R0082:Tie1 UTSW 4 118484353 missense probably damaging 1.00
R0098:Tie1 UTSW 4 118486587 missense probably benign
R0329:Tie1 UTSW 4 118484727 missense probably benign 0.24
R0330:Tie1 UTSW 4 118484727 missense probably benign 0.24
R0410:Tie1 UTSW 4 118480569 missense probably damaging 1.00
R0472:Tie1 UTSW 4 118476147 missense possibly damaging 0.61
R0498:Tie1 UTSW 4 118479161 utr 3 prime probably benign
R0521:Tie1 UTSW 4 118476146 missense probably damaging 1.00
R0609:Tie1 UTSW 4 118476147 missense possibly damaging 0.61
R0675:Tie1 UTSW 4 118479769 nonsense probably null
R0830:Tie1 UTSW 4 118482663 missense probably damaging 1.00
R1541:Tie1 UTSW 4 118483873 missense probably damaging 0.99
R1604:Tie1 UTSW 4 118474407 missense probably damaging 1.00
R1731:Tie1 UTSW 4 118476263 missense probably damaging 1.00
R1751:Tie1 UTSW 4 118476176 missense possibly damaging 0.87
R1767:Tie1 UTSW 4 118476176 missense possibly damaging 0.87
R1953:Tie1 UTSW 4 118472790 critical splice donor site probably null
R1986:Tie1 UTSW 4 118478963 missense probably benign
R2141:Tie1 UTSW 4 118472811 nonsense probably null
R3150:Tie1 UTSW 4 118475825 missense probably damaging 1.00
R4235:Tie1 UTSW 4 118478405 nonsense probably null
R4599:Tie1 UTSW 4 118472634 missense probably benign 0.00
R4614:Tie1 UTSW 4 118479051 missense probably damaging 1.00
R4623:Tie1 UTSW 4 118486611 missense possibly damaging 0.71
R4638:Tie1 UTSW 4 118483842 missense probably benign 0.00
R4717:Tie1 UTSW 4 118486217 missense probably damaging 1.00
R4936:Tie1 UTSW 4 118484771 splice site silent
R4983:Tie1 UTSW 4 118483755 missense probably damaging 1.00
R5202:Tie1 UTSW 4 118480510 missense probably benign 0.01
R5234:Tie1 UTSW 4 118482762 missense probably benign 0.22
R5243:Tie1 UTSW 4 118482351 missense probably damaging 0.99
R5538:Tie1 UTSW 4 118486193 missense probably benign 0.10
R5881:Tie1 UTSW 4 118475603 missense possibly damaging 0.89
R6045:Tie1 UTSW 4 118484691 missense probably benign 0.05
R6073:Tie1 UTSW 4 118482390 missense probably benign
R6476:Tie1 UTSW 4 118472865 missense possibly damaging 0.82
R6820:Tie1 UTSW 4 118484386 missense probably damaging 1.00
R6961:Tie1 UTSW 4 118486205 missense probably damaging 1.00
R7029:Tie1 UTSW 4 118484626 missense possibly damaging 0.93
R7147:Tie1 UTSW 4 118484413 missense probably damaging 1.00
R7249:Tie1 UTSW 4 118486228 missense probably benign 0.29
Z1088:Tie1 UTSW 4 118484429 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGTCCTCTGTGTAGTCTAGGC -3'
(R):5'- TACAGGCGACAACTCTTCCC -3'

Sequencing Primer
(F):5'- CCTTCCAAGTGCTGGGATTAAAG -3'
(R):5'- GCGACAACTCTTCCCACCCTC -3'
Posted On2019-05-13