Incidental Mutation 'R7022:Enpp3'
ID545704
Institutional Source Beutler Lab
Gene Symbol Enpp3
Ensembl Gene ENSMUSG00000019989
Gene Nameectonucleotide pyrophosphatase/phosphodiesterase 3
SynonymsCD203c
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.263) question?
Stock #R7022 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location24772406-24842823 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 24826195 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 60 (E60D)
Ref Sequence ENSEMBL: ENSMUSP00000152033 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020169] [ENSMUST00000217903] [ENSMUST00000218044] [ENSMUST00000219342] [ENSMUST00000219968] [ENSMUST00000220209]
Predicted Effect probably benign
Transcript: ENSMUST00000020169
AA Change: E86D

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000020169
Gene: ENSMUSG00000019989
AA Change: E86D

DomainStartEndE-ValueType
transmembrane domain 23 45 N/A INTRINSIC
SO 50 93 1.99e-13 SMART
SO 94 137 7.66e-15 SMART
Pfam:Phosphodiest 161 485 1.7e-87 PFAM
Blast:Endonuclease_NS 543 599 9e-15 BLAST
Endonuclease_NS 626 847 5.41e-16 SMART
NUC 627 856 1.54e-92 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000217903
AA Change: E60D

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Predicted Effect possibly damaging
Transcript: ENSMUST00000218044
AA Change: E86D

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000219342
Predicted Effect probably benign
Transcript: ENSMUST00000219968
Predicted Effect unknown
Transcript: ENSMUST00000220209
AA Change: K61M
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a series of ectoenzymes that are involved in hydrolysis of extracellular nucleotides. These ectoenzymes possess ATPase and ATP pyrophosphatase activities and are type II transmembrane proteins. Expression of the related rat mRNA has been found in a subset of immature glial cells and in the alimentary tract. The corresponding rat protein has been detected in the pancreas, small intestine, colon, and liver. The human mRNA is expressed in glioma cells, prostate, and uterus. Expression of the human protein has been detected in uterus, basophils, and mast cells. Two transcript variants, one protein coding and the other non-protein coding, have been found for this gene. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a knockout allele exhibit increased numbers of basophils and mast cells with increased susceptibility to chronic allergic responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A T 11: 110,083,500 S203T probably damaging Het
Adat1 A T 8: 111,989,862 M76K probably damaging Het
Ankrd33 G C 15: 101,116,899 V56L probably benign Het
Ascc3 T A 10: 50,716,629 L1134I possibly damaging Het
C3 T G 17: 57,217,286 D948A probably damaging Het
Ccdc40 A G 11: 119,231,786 E138G possibly damaging Het
Cd80 A G 16: 38,486,504 probably null Het
Cdca7 T A 2: 72,479,529 probably null Het
Chit1 A G 1: 134,151,292 S447G probably benign Het
Cmya5 C T 13: 93,069,278 probably null Het
Cnnm2 T A 19: 46,858,940 probably null Het
Cnnm2 A T 19: 46,762,550 I260F probably damaging Het
Col1a2 T C 6: 4,534,639 L881P unknown Het
Crebbp A T 16: 4,117,323 S901T probably damaging Het
Dcun1d2 T C 8: 13,271,637 Y158C probably damaging Het
Dnhd1 C T 7: 105,720,798 P4477S probably benign Het
Donson A G 16: 91,681,330 Y428H probably damaging Het
Dsp G T 13: 38,191,740 W1167L probably benign Het
Elmo2 C T 2: 165,295,041 V592M probably damaging Het
Fam83b TAAGA T 9: 76,502,112 probably null Het
Fbxo38 A G 18: 62,536,224 C52R probably damaging Het
Gm10912 T C 2: 104,066,710 W65R probably damaging Het
Gm43518 A T 5: 123,936,427 M44L probably benign Het
Gm4881 A T 7: 24,931,664 probably null Het
Gm6583 A C 5: 112,355,529 M103R probably benign Het
Gnb1 T A 4: 155,553,456 D212E probably damaging Het
Gnl1 A G 17: 35,988,728 N597S probably damaging Het
Gprin1 T G 13: 54,739,042 E473A probably benign Het
Ighv1-69 T A 12: 115,623,214 M100L probably benign Het
Igkv14-100 T C 6: 68,519,209 S29P probably damaging Het
Ints6 A G 14: 62,714,337 V232A probably damaging Het
Jup A G 11: 100,379,553 L376P probably damaging Het
Kdr A T 5: 75,972,260 Y119* probably null Het
Kif1a T G 1: 93,066,098 T377P probably benign Het
Lama5 C A 2: 180,180,731 V2850L probably damaging Het
Lrp2 T C 2: 69,483,208 Y2393C probably damaging Het
Mfsd13a C T 19: 46,368,324 Q255* probably null Het
Msh3 A C 13: 92,235,588 D891E probably damaging Het
Msl2 A G 9: 101,075,282 N2D possibly damaging Het
Myo19 T C 11: 84,900,547 L476P probably damaging Het
Nbeal2 G A 9: 110,638,618 R501W probably damaging Het
Nfasc C A 1: 132,621,049 K293N probably damaging Het
Npbwr1 A T 1: 5,917,100 L65Q probably damaging Het
Nrbp1 T A 5: 31,244,481 D34E probably damaging Het
Nup205 T A 6: 35,243,936 V1891D probably benign Het
Olfr172 T C 16: 58,761,119 N19S probably benign Het
Olfr577 T A 7: 102,973,968 N8I possibly damaging Het
Olfr936 G T 9: 39,047,083 C156* probably null Het
Olfr998 T A 2: 85,590,598 D19E probably benign Het
Oscp1 G A 4: 126,082,990 probably null Het
Pcdhgb7 A G 18: 37,753,033 T419A probably damaging Het
Pdzph1 T C 17: 58,974,126 D387G probably benign Het
Phc1 A G 6: 122,335,031 F56S probably damaging Het
Pik3c2g A G 6: 139,622,063 E59G possibly damaging Het
Prickle1 G T 15: 93,500,871 T692K possibly damaging Het
Rbm45 T A 2: 76,376,394 L250Q probably damaging Het
Ror1 T A 4: 100,407,911 M194K probably damaging Het
Rrbp1 T A 2: 143,957,802 probably null Het
Rundc3b T C 5: 8,512,348 K340R probably null Het
Scn1a T A 2: 66,317,899 T1101S probably damaging Het
Sdk1 C G 5: 142,094,657 probably null Het
Skiv2l A G 17: 34,845,207 F501S possibly damaging Het
Slc20a1 T A 2: 129,200,059 M114K probably damaging Het
Sorl1 A C 9: 41,969,751 I2158S probably benign Het
Strip1 A T 3: 107,626,795 F174L probably benign Het
Sucnr1 A T 3: 60,086,278 I76L probably benign Het
Syt17 C T 7: 118,408,019 V412I probably benign Het
Tie1 T A 4: 118,489,653 H18L probably benign Het
Tpp1 T G 7: 105,748,922 K345Q probably damaging Het
Trcg1 G A 9: 57,241,569 M141I possibly damaging Het
Trpc4ap T C 2: 155,657,822 N260S probably benign Het
Vps41 C A 13: 18,842,268 T512K possibly damaging Het
Vps52 A T 17: 33,959,319 M147L probably benign Het
Ywhaq A G 12: 21,391,751 probably benign Het
Zfp619 A G 7: 39,534,963 N139S probably benign Het
Other mutations in Enpp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00519:Enpp3 APN 10 24787772 missense probably benign 0.00
IGL00778:Enpp3 APN 10 24798262 missense probably damaging 1.00
IGL01147:Enpp3 APN 10 24774907 missense probably damaging 1.00
IGL01343:Enpp3 APN 10 24805922 nonsense probably null
IGL01642:Enpp3 APN 10 24798269 missense probably damaging 1.00
IGL01814:Enpp3 APN 10 24792025 missense possibly damaging 0.68
IGL02083:Enpp3 APN 10 24776794 missense probably damaging 1.00
IGL02152:Enpp3 APN 10 24774002 missense probably damaging 1.00
IGL02186:Enpp3 APN 10 24791983 splice site probably benign
IGL02517:Enpp3 APN 10 24809848 splice site probably benign
IGL02956:Enpp3 APN 10 24774943 splice site probably benign
R0017:Enpp3 UTSW 10 24799153 splice site probably null
R0042:Enpp3 UTSW 10 24774824 missense probably damaging 1.00
R0110:Enpp3 UTSW 10 24776781 missense probably damaging 1.00
R0218:Enpp3 UTSW 10 24776869 missense possibly damaging 0.80
R0403:Enpp3 UTSW 10 24804436 missense probably damaging 1.00
R0433:Enpp3 UTSW 10 24820597 missense probably benign 0.00
R0450:Enpp3 UTSW 10 24776781 missense probably damaging 1.00
R0510:Enpp3 UTSW 10 24776781 missense probably damaging 1.00
R0826:Enpp3 UTSW 10 24795716 missense probably damaging 1.00
R1245:Enpp3 UTSW 10 24784953 splice site probably benign
R1261:Enpp3 UTSW 10 24774934 missense probably damaging 0.97
R1633:Enpp3 UTSW 10 24795782 missense probably damaging 1.00
R1903:Enpp3 UTSW 10 24778789 missense probably damaging 1.00
R1913:Enpp3 UTSW 10 24776771 nonsense probably null
R1966:Enpp3 UTSW 10 24807491 missense probably damaging 0.99
R2157:Enpp3 UTSW 10 24776878 missense probably damaging 1.00
R2179:Enpp3 UTSW 10 24805895 missense probably benign 0.00
R2380:Enpp3 UTSW 10 24776872 missense probably benign
R2410:Enpp3 UTSW 10 24774818 missense probably benign 0.00
R3794:Enpp3 UTSW 10 24831732 splice site probably null
R3896:Enpp3 UTSW 10 24777949 missense possibly damaging 0.79
R4334:Enpp3 UTSW 10 24793589 missense probably damaging 1.00
R4569:Enpp3 UTSW 10 24776882 missense probably damaging 1.00
R4766:Enpp3 UTSW 10 24773927 missense probably damaging 1.00
R4951:Enpp3 UTSW 10 24798277 missense probably damaging 1.00
R4998:Enpp3 UTSW 10 24807538 missense probably benign 0.01
R5045:Enpp3 UTSW 10 24776767 missense probably damaging 1.00
R5276:Enpp3 UTSW 10 24809916 missense probably damaging 1.00
R5331:Enpp3 UTSW 10 24808160 missense probably damaging 1.00
R5569:Enpp3 UTSW 10 24778821 missense probably damaging 0.98
R5975:Enpp3 UTSW 10 24774842 missense probably benign 0.37
R6117:Enpp3 UTSW 10 24787852 missense probably damaging 1.00
R6419:Enpp3 UTSW 10 24808191 missense probably damaging 1.00
R6677:Enpp3 UTSW 10 24777957 missense possibly damaging 0.88
R6735:Enpp3 UTSW 10 24807453 missense probably damaging 1.00
R6833:Enpp3 UTSW 10 24809870 missense probably damaging 1.00
R6999:Enpp3 UTSW 10 24808166 missense probably damaging 1.00
R7173:Enpp3 UTSW 10 24774047 missense probably damaging 1.00
R7224:Enpp3 UTSW 10 24776884 missense possibly damaging 0.63
R7227:Enpp3 UTSW 10 24817844 missense unknown
X0026:Enpp3 UTSW 10 24826242 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGATCATGTGACAGGGAAGGTC -3'
(R):5'- TTTGTTCTCATCCGCTAGGG -3'

Sequencing Primer
(F):5'- CTGCCAACACGTAGATGTTG -3'
(R):5'- GATGAAGCACTGGCCAACTTCTTAG -3'
Posted On2019-05-13