Incidental Mutation 'R7022:Ints6'
ID545717
Institutional Source Beutler Lab
Gene Symbol Ints6
Ensembl Gene ENSMUSG00000035161
Gene Nameintegrator complex subunit 6
SynonymsDICE1, Notch2l, Ddx26, 2900075H24Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7022 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location62676330-62761169 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 62714337 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 232 (V232A)
Ref Sequence ENSEMBL: ENSMUSP00000152954 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053959] [ENSMUST00000223585]
Predicted Effect probably damaging
Transcript: ENSMUST00000053959
AA Change: V232A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000086788
Gene: ENSMUSG00000035161
AA Change: V232A

DomainStartEndE-ValueType
VWA 1 158 4.11e-1 SMART
Blast:VWA 307 331 1e-7 BLAST
Blast:RRM_2 701 727 3e-8 BLAST
Pfam:INT_SG_DDX_CT_C 803 865 4e-30 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000223585
AA Change: V232A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. The protein encoded by this gene is a DEAD box protein that is part of a complex that interacts with the C-terminus of RNA polymerase II and is involved in 3' end processing of snRNAs. In addition, this gene is a candidate tumor suppressor and is located in the critical region of loss of heterozygosity (LOH). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E7. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A T 11: 110,083,500 S203T probably damaging Het
Adat1 A T 8: 111,989,862 M76K probably damaging Het
Ankrd33 G C 15: 101,116,899 V56L probably benign Het
Ascc3 T A 10: 50,716,629 L1134I possibly damaging Het
C3 T G 17: 57,217,286 D948A probably damaging Het
Ccdc40 A G 11: 119,231,786 E138G possibly damaging Het
Cd80 A G 16: 38,486,504 probably null Het
Cdca7 T A 2: 72,479,529 probably null Het
Chit1 A G 1: 134,151,292 S447G probably benign Het
Cmya5 C T 13: 93,069,278 probably null Het
Cnnm2 A T 19: 46,762,550 I260F probably damaging Het
Cnnm2 T A 19: 46,858,940 probably null Het
Col1a2 T C 6: 4,534,639 L881P unknown Het
Crebbp A T 16: 4,117,323 S901T probably damaging Het
Dcun1d2 T C 8: 13,271,637 Y158C probably damaging Het
Dnhd1 C T 7: 105,720,798 P4477S probably benign Het
Donson A G 16: 91,681,330 Y428H probably damaging Het
Dsp G T 13: 38,191,740 W1167L probably benign Het
Elmo2 C T 2: 165,295,041 V592M probably damaging Het
Enpp3 T A 10: 24,826,195 E60D probably damaging Het
Fam83b TAAGA T 9: 76,502,112 probably null Het
Fbxo38 A G 18: 62,536,224 C52R probably damaging Het
Gm10912 T C 2: 104,066,710 W65R probably damaging Het
Gm43518 A T 5: 123,936,427 M44L probably benign Het
Gm4881 A T 7: 24,931,664 probably null Het
Gm6583 A C 5: 112,355,529 M103R probably benign Het
Gnb1 T A 4: 155,553,456 D212E probably damaging Het
Gnl1 A G 17: 35,988,728 N597S probably damaging Het
Gprin1 T G 13: 54,739,042 E473A probably benign Het
Ighv1-69 T A 12: 115,623,214 M100L probably benign Het
Igkv14-100 T C 6: 68,519,209 S29P probably damaging Het
Jup A G 11: 100,379,553 L376P probably damaging Het
Kdr A T 5: 75,972,260 Y119* probably null Het
Kif1a T G 1: 93,066,098 T377P probably benign Het
Lama5 C A 2: 180,180,731 V2850L probably damaging Het
Lrp2 T C 2: 69,483,208 Y2393C probably damaging Het
Mfsd13a C T 19: 46,368,324 Q255* probably null Het
Msh3 A C 13: 92,235,588 D891E probably damaging Het
Msl2 A G 9: 101,075,282 N2D possibly damaging Het
Myo19 T C 11: 84,900,547 L476P probably damaging Het
Nbeal2 G A 9: 110,638,618 R501W probably damaging Het
Nfasc C A 1: 132,621,049 K293N probably damaging Het
Npbwr1 A T 1: 5,917,100 L65Q probably damaging Het
Nrbp1 T A 5: 31,244,481 D34E probably damaging Het
Nup205 T A 6: 35,243,936 V1891D probably benign Het
Olfr172 T C 16: 58,761,119 N19S probably benign Het
Olfr577 T A 7: 102,973,968 N8I possibly damaging Het
Olfr936 G T 9: 39,047,083 C156* probably null Het
Olfr998 T A 2: 85,590,598 D19E probably benign Het
Oscp1 G A 4: 126,082,990 probably null Het
Pcdhgb7 A G 18: 37,753,033 T419A probably damaging Het
Pdzph1 T C 17: 58,974,126 D387G probably benign Het
Phc1 A G 6: 122,335,031 F56S probably damaging Het
Pik3c2g A G 6: 139,622,063 E59G possibly damaging Het
Prickle1 G T 15: 93,500,871 T692K possibly damaging Het
Rbm45 T A 2: 76,376,394 L250Q probably damaging Het
Ror1 T A 4: 100,407,911 M194K probably damaging Het
Rrbp1 T A 2: 143,957,802 probably null Het
Rundc3b T C 5: 8,512,348 K340R probably null Het
Scn1a T A 2: 66,317,899 T1101S probably damaging Het
Sdk1 C G 5: 142,094,657 probably null Het
Skiv2l A G 17: 34,845,207 F501S possibly damaging Het
Slc20a1 T A 2: 129,200,059 M114K probably damaging Het
Sorl1 A C 9: 41,969,751 I2158S probably benign Het
Strip1 A T 3: 107,626,795 F174L probably benign Het
Sucnr1 A T 3: 60,086,278 I76L probably benign Het
Syt17 C T 7: 118,408,019 V412I probably benign Het
Tie1 T A 4: 118,489,653 H18L probably benign Het
Tpp1 T G 7: 105,748,922 K345Q probably damaging Het
Trcg1 G A 9: 57,241,569 M141I possibly damaging Het
Trpc4ap T C 2: 155,657,822 N260S probably benign Het
Vps41 C A 13: 18,842,268 T512K possibly damaging Het
Vps52 A T 17: 33,959,319 M147L probably benign Het
Ywhaq A G 12: 21,391,751 probably benign Het
Zfp619 A G 7: 39,534,963 N139S probably benign Het
Other mutations in Ints6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00535:Ints6 APN 14 62703179 missense probably damaging 1.00
IGL00763:Ints6 APN 14 62700865 splice site probably benign
IGL01624:Ints6 APN 14 62696871 missense probably benign 0.07
IGL01721:Ints6 APN 14 62713739 missense probably damaging 0.96
IGL02146:Ints6 APN 14 62759260 missense possibly damaging 0.91
R0302:Ints6 UTSW 14 62709512 missense probably damaging 1.00
R0320:Ints6 UTSW 14 62707635 nonsense probably null
R0543:Ints6 UTSW 14 62696611 missense probably damaging 1.00
R0554:Ints6 UTSW 14 62704751 missense possibly damaging 0.87
R0620:Ints6 UTSW 14 62696759 missense probably benign
R0960:Ints6 UTSW 14 62709566 missense probably benign 0.39
R1216:Ints6 UTSW 14 62707698 missense probably damaging 1.00
R1254:Ints6 UTSW 14 62716374 missense probably benign 0.27
R1296:Ints6 UTSW 14 62704903 splice site probably benign
R1548:Ints6 UTSW 14 62713692 missense probably damaging 1.00
R1944:Ints6 UTSW 14 62693640 missense probably benign 0.03
R2040:Ints6 UTSW 14 62713689 missense probably damaging 0.99
R2279:Ints6 UTSW 14 62704682 critical splice donor site probably null
R2844:Ints6 UTSW 14 62704826 missense probably damaging 0.97
R3107:Ints6 UTSW 14 62760592 missense possibly damaging 0.92
R3407:Ints6 UTSW 14 62696937 missense probably benign 0.00
R3895:Ints6 UTSW 14 62696611 missense probably damaging 1.00
R4608:Ints6 UTSW 14 62703229 missense probably damaging 1.00
R4903:Ints6 UTSW 14 62702462 missense probably damaging 1.00
R4964:Ints6 UTSW 14 62702462 missense probably damaging 1.00
R4966:Ints6 UTSW 14 62702462 missense probably damaging 1.00
R5014:Ints6 UTSW 14 62760191 missense probably benign 0.00
R5369:Ints6 UTSW 14 62743935 missense probably damaging 1.00
R6478:Ints6 UTSW 14 62700786 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- CATGACAACTGGCCTTGTTAATC -3'
(R):5'- GGAAATACCGACCACTTAGTTTC -3'

Sequencing Primer
(F):5'- AGCTAGGATCTCTATGTAGTCCTGC -3'
(R):5'- GTCCTTATGGGAGTTTGAC -3'
Posted On2019-05-13