Incidental Mutation 'R7023:9530053A07Rik'
ID545768
Institutional Source Beutler Lab
Gene Symbol 9530053A07Rik
Ensembl Gene ENSMUSG00000078776
Gene NameRIKEN cDNA 9530053A07 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.152) question?
Stock #R7023 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location28129466-28164811 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 28140038 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 425 (C425*)
Ref Sequence ENSEMBL: ENSMUSP00000114986 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059886] [ENSMUST00000150948]
Predicted Effect probably null
Transcript: ENSMUST00000059886
AA Change: C425*
SMART Domains Protein: ENSMUSP00000056479
Gene: ENSMUSG00000078776
AA Change: C425*

DomainStartEndE-ValueType
low complexity region 8 24 N/A INTRINSIC
FOLN 27 49 1.23e-4 SMART
VWD 46 211 1.5e-40 SMART
C8 251 326 4.31e-33 SMART
Pfam:TIL 329 383 2e-13 PFAM
VWC 385 448 1.02e0 SMART
VWD 439 603 4.32e-32 SMART
C8 640 715 4.54e-9 SMART
Pfam:TIL 718 771 1.6e-12 PFAM
VWC 773 826 1.1e0 SMART
FOLN 805 827 6.87e1 SMART
VWD 825 988 7.92e-40 SMART
C8 1033 1108 5.1e-35 SMART
Pfam:TIL 1111 1164 7.6e-11 PFAM
VWC 1166 1224 1.1e-2 SMART
FOLN 1197 1219 9.55e-1 SMART
FOLN 1223 1245 5.38e1 SMART
VWD 1241 1410 9.04e-35 SMART
C8 1450 1526 9.54e-26 SMART
low complexity region 1540 1550 N/A INTRINSIC
EGF_like 1557 1580 5.34e1 SMART
VWC 1588 1681 3.21e-3 SMART
VWD 1639 1806 7.3e-30 SMART
C8 1838 1913 2.44e-32 SMART
EGF_like 1941 1964 4.46e1 SMART
VWC 1971 2062 2.85e-1 SMART
VWD 2022 2178 1.32e-27 SMART
low complexity region 2199 2212 N/A INTRINSIC
C8 2219 2294 1.43e-29 SMART
Pfam:TIL 2297 2350 1.1e-11 PFAM
FOLN 2383 2405 5.68e1 SMART
VWD 2402 2564 4.58e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129051
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130693
Predicted Effect probably null
Transcript: ENSMUST00000150948
AA Change: C425*
SMART Domains Protein: ENSMUSP00000114986
Gene: ENSMUSG00000078776
AA Change: C425*

DomainStartEndE-ValueType
low complexity region 8 24 N/A INTRINSIC
FOLN 27 49 1.23e-4 SMART
VWD 46 211 1.5e-40 SMART
C8 251 326 4.31e-33 SMART
Pfam:TIL 329 383 2e-13 PFAM
VWC 385 448 1.02e0 SMART
VWD 439 603 4.32e-32 SMART
C8 640 715 4.54e-9 SMART
Pfam:TIL 718 771 1.6e-12 PFAM
VWC 773 826 1.1e0 SMART
FOLN 805 827 6.87e1 SMART
VWD 825 988 7.92e-40 SMART
C8 1033 1108 5.1e-35 SMART
Pfam:TIL 1111 1164 7.6e-11 PFAM
VWC 1166 1224 1.1e-2 SMART
FOLN 1197 1219 9.55e-1 SMART
FOLN 1223 1245 5.38e1 SMART
VWD 1241 1410 9.04e-35 SMART
C8 1450 1526 9.54e-26 SMART
low complexity region 1540 1550 N/A INTRINSIC
EGF_like 1557 1580 5.34e1 SMART
VWC 1588 1681 3.21e-3 SMART
VWD 1639 1806 7.3e-30 SMART
C8 1838 1913 2.44e-32 SMART
EGF_like 1941 1964 4.46e1 SMART
VWC 1971 2062 2.85e-1 SMART
VWD 2022 2178 1.32e-27 SMART
low complexity region 2199 2212 N/A INTRINSIC
C8 2219 2294 1.43e-29 SMART
Pfam:TIL 2297 2350 1.1e-11 PFAM
FOLN 2383 2405 5.68e1 SMART
VWD 2402 2564 4.58e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik A G 13: 119,473,907 H372R probably benign Het
4933405O20Rik T C 7: 50,600,253 I345T probably damaging Het
4933427D14Rik A G 11: 72,178,403 probably null Het
6430548M08Rik T C 8: 120,145,357 V8A probably damaging Het
Adam2 A T 14: 66,043,056 D501E probably benign Het
Agbl3 T C 6: 34,814,769 V602A probably benign Het
Akap12 T C 10: 4,356,895 M1235T probably benign Het
Arid5a G A 1: 36,317,550 probably benign Het
Asxl1 T A 2: 153,400,549 D1006E probably benign Het
AY074887 T C 9: 54,950,865 probably benign Het
Btbd9 T A 17: 30,527,572 R93S probably benign Het
Cabp2 A T 19: 4,082,658 probably null Het
Cacna1e T C 1: 154,725,693 D76G probably null Het
Cd177 A G 7: 24,759,762 I74T probably benign Het
Chchd1 G A 14: 20,703,242 probably benign Het
Col28a1 T C 6: 8,083,763 R565G possibly damaging Het
Cpvl T A 6: 53,967,812 I80F probably benign Het
Csgalnact1 T C 8: 68,358,429 T530A probably benign Het
Cybrd1 A G 2: 71,138,578 D265G probably benign Het
Cyp2c69 A T 19: 39,877,542 N202K probably benign Het
D1Pas1 A G 1: 186,968,008 N45D probably damaging Het
Dclre1a A G 19: 56,540,206 V839A probably damaging Het
Degs1 A T 1: 182,279,065 Y210N probably damaging Het
Doc2g A G 19: 4,004,778 S220G probably benign Het
Epb41l2 T A 10: 25,512,977 L885Q probably damaging Het
Fabp1 A T 6: 71,203,085 probably null Het
Fat2 G A 11: 55,310,502 S582L probably benign Het
Fras1 A G 5: 96,710,084 N2079S probably benign Het
Gdf6 T C 4: 9,860,210 Y431H probably damaging Het
Gfra1 A T 19: 58,454,332 L6Q probably damaging Het
Gm45861 T G 8: 27,581,006 S1305A unknown Het
Gse1 T C 8: 120,230,648 probably benign Het
Kmt2e A G 5: 23,500,487 H1303R possibly damaging Het
Lck T C 4: 129,548,865 D499G possibly damaging Het
Lepr A T 4: 101,789,287 Y805F probably damaging Het
Lin7a A T 10: 107,382,628 Y11F possibly damaging Het
Lrrc43 A G 5: 123,503,763 K559E probably damaging Het
Megf6 T C 4: 154,254,145 L467P possibly damaging Het
Mprip G A 11: 59,737,389 G221R probably damaging Het
Myo5c T C 9: 75,301,456 V1683A probably damaging Het
Nbeal2 G A 9: 110,638,618 R501W probably damaging Het
Ncf1 G T 5: 134,225,262 A219E possibly damaging Het
Nckap1l T C 15: 103,476,066 I616T probably benign Het
Nlrp2 A T 7: 5,328,229 C389* probably null Het
Nrg3 T C 14: 38,376,376 E507G probably damaging Het
Olfr1180 A G 2: 88,412,415 L81P probably damaging Het
P4ha2 A T 11: 54,131,246 T532S probably benign Het
Pappa A T 4: 65,351,718 H1623L probably benign Het
Paqr6 A G 3: 88,366,046 Y115C probably damaging Het
Pcolce2 A T 9: 95,678,468 Q190L probably benign Het
Poll A G 19: 45,558,838 I65T probably benign Het
Prmt9 T C 8: 77,549,457 probably benign Het
Prpf39 T C 12: 65,053,300 V130A possibly damaging Het
Prpf6 A G 2: 181,620,640 D144G probably damaging Het
Rgs6 T A 12: 83,092,104 probably benign Het
Rimbp2 A G 5: 128,802,783 probably null Het
Ripor2 A G 13: 24,671,846 T90A probably benign Het
Rnf150 T C 8: 82,864,077 F23S probably damaging Het
Rpp40 G A 13: 35,898,906 R200W possibly damaging Het
Rtp3 G A 9: 110,986,646 S217L probably benign Het
Sacs A C 14: 61,208,815 K2770T probably benign Het
Scn10a A T 9: 119,613,544 I1545N probably damaging Het
Scn2b G T 9: 45,126,140 V162L probably damaging Het
Sema6d A G 2: 124,664,911 T880A probably damaging Het
Slc36a4 A G 9: 15,719,633 D16G probably benign Het
Slc4a8 T A 15: 100,791,643 I378K probably benign Het
Smco2 T A 6: 146,858,856 L70* probably null Het
Sptb C T 12: 76,625,088 V364I probably damaging Het
Susd4 A G 1: 182,765,048 H3R probably damaging Het
Tbc1d16 T C 11: 119,158,791 Q293R probably damaging Het
Tnfsf9 T A 17: 57,107,317 M248K possibly damaging Het
Toporsl A G 4: 52,611,211 N368S possibly damaging Het
Trip11 T C 12: 101,885,867 E361G probably benign Het
Trrap T A 5: 144,792,154 M626K possibly damaging Het
Ttn A T 2: 76,942,874 S2395T probably damaging Het
Ubqln3 T C 7: 104,141,423 R487G probably damaging Het
Vdac1 A G 11: 52,374,366 Y22C probably damaging Het
Vmn1r59 C T 7: 5,454,478 M94I probably benign Het
Vmn2r10 G T 5: 109,002,028 D383E probably damaging Het
Vmn2r115 T C 17: 23,359,811 Y753H probably damaging Het
Vmn2r97 G T 17: 18,914,401 C27F probably damaging Het
Wasf1 T A 10: 40,936,475 V420E unknown Het
Zfp94 A T 7: 24,303,396 L201Q probably damaging Het
Zgpat TGGAGGAGGAGGAGGAGGA TGGAGGAGGAGGAGGA 2: 181,366,018 probably benign Het
Zmym4 C A 4: 126,868,800 R1410L probably damaging Het
Other mutations in 9530053A07Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:9530053A07Rik APN 7 28164528 missense probably damaging 1.00
IGL00757:9530053A07Rik APN 7 28154445 missense probably damaging 1.00
IGL01015:9530053A07Rik APN 7 28155318 missense probably damaging 1.00
IGL01079:9530053A07Rik APN 7 28139778 missense probably damaging 0.99
IGL01343:9530053A07Rik APN 7 28150702 missense probably benign 0.19
IGL01420:9530053A07Rik APN 7 28140133 missense probably benign 0.28
IGL01604:9530053A07Rik APN 7 28155324 missense probably benign 0.11
IGL01666:9530053A07Rik APN 7 28153292 missense probably damaging 1.00
IGL02002:9530053A07Rik APN 7 28152796 missense probably damaging 1.00
IGL02036:9530053A07Rik APN 7 28137525 missense possibly damaging 0.82
IGL02126:9530053A07Rik APN 7 28139856 missense probably damaging 1.00
IGL02150:9530053A07Rik APN 7 28146779 nonsense probably null
IGL02219:9530053A07Rik APN 7 28154635 missense probably damaging 1.00
IGL02563:9530053A07Rik APN 7 28157892 missense probably benign
IGL02804:9530053A07Rik APN 7 28153370 missense probably benign 0.00
IGL02830:9530053A07Rik APN 7 28162923 missense probably damaging 1.00
IGL02943:9530053A07Rik APN 7 28147188 missense probably damaging 1.00
IGL02977:9530053A07Rik APN 7 28164372 missense possibly damaging 0.83
IGL03231:9530053A07Rik APN 7 28153722 missense possibly damaging 0.95
IGL03304:9530053A07Rik APN 7 28142242 missense probably damaging 0.99
PIT4378001:9530053A07Rik UTSW 7 28154464 missense possibly damaging 0.61
R0023:9530053A07Rik UTSW 7 28153412 missense probably benign 0.00
R0131:9530053A07Rik UTSW 7 28137615 missense probably damaging 1.00
R0131:9530053A07Rik UTSW 7 28137615 missense probably damaging 1.00
R0132:9530053A07Rik UTSW 7 28137615 missense probably damaging 1.00
R0158:9530053A07Rik UTSW 7 28155492 missense probably damaging 1.00
R0230:9530053A07Rik UTSW 7 28156825 missense probably damaging 1.00
R0310:9530053A07Rik UTSW 7 28142274 missense probably benign 0.04
R0448:9530053A07Rik UTSW 7 28140235 missense probably benign 0.03
R0462:9530053A07Rik UTSW 7 28137340 missense probably damaging 1.00
R0481:9530053A07Rik UTSW 7 28153749 missense probably damaging 1.00
R0497:9530053A07Rik UTSW 7 28147465 missense probably damaging 1.00
R0556:9530053A07Rik UTSW 7 28159378 missense probably benign
R0562:9530053A07Rik UTSW 7 28162690 missense probably benign 0.30
R0586:9530053A07Rik UTSW 7 28137091 missense probably damaging 0.99
R0924:9530053A07Rik UTSW 7 28140130 missense probably damaging 1.00
R0930:9530053A07Rik UTSW 7 28140130 missense probably damaging 1.00
R1103:9530053A07Rik UTSW 7 28154520 missense probably damaging 1.00
R1213:9530053A07Rik UTSW 7 28157673 missense probably damaging 1.00
R1292:9530053A07Rik UTSW 7 28142794 splice site probably benign
R1368:9530053A07Rik UTSW 7 28159478 missense possibly damaging 0.89
R1451:9530053A07Rik UTSW 7 28137157 missense probably damaging 1.00
R1477:9530053A07Rik UTSW 7 28157093 missense probably benign 0.01
R1538:9530053A07Rik UTSW 7 28155492 missense probably damaging 1.00
R1655:9530053A07Rik UTSW 7 28147110 missense probably damaging 0.98
R1697:9530053A07Rik UTSW 7 28154347 missense probably damaging 1.00
R1741:9530053A07Rik UTSW 7 28157854 missense probably damaging 0.98
R1796:9530053A07Rik UTSW 7 28155372 missense probably damaging 1.00
R1853:9530053A07Rik UTSW 7 28155546 nonsense probably null
R1861:9530053A07Rik UTSW 7 28154732 missense probably damaging 1.00
R1909:9530053A07Rik UTSW 7 28144348 missense possibly damaging 0.52
R1971:9530053A07Rik UTSW 7 28131512 missense possibly damaging 0.90
R1990:9530053A07Rik UTSW 7 28154360 missense probably damaging 0.98
R2020:9530053A07Rik UTSW 7 28155594 missense probably benign
R2084:9530053A07Rik UTSW 7 28157535 missense probably damaging 1.00
R2125:9530053A07Rik UTSW 7 28158022 missense probably benign 0.00
R2132:9530053A07Rik UTSW 7 28155474 missense probably damaging 1.00
R2513:9530053A07Rik UTSW 7 28131635 missense probably damaging 0.99
R2913:9530053A07Rik UTSW 7 28164307 missense probably damaging 1.00
R3150:9530053A07Rik UTSW 7 28154195 missense probably benign 0.21
R3499:9530053A07Rik UTSW 7 28154555 missense probably benign 0.42
R3702:9530053A07Rik UTSW 7 28157778 missense probably damaging 1.00
R3881:9530053A07Rik UTSW 7 28140038 nonsense probably null
R3938:9530053A07Rik UTSW 7 28154294 missense probably damaging 1.00
R4050:9530053A07Rik UTSW 7 28152985 missense possibly damaging 0.55
R4152:9530053A07Rik UTSW 7 28156897 missense possibly damaging 0.47
R4168:9530053A07Rik UTSW 7 28137109 missense probably benign 0.05
R4235:9530053A07Rik UTSW 7 28156648 missense probably damaging 0.99
R4241:9530053A07Rik UTSW 7 28154335 missense probably damaging 1.00
R4363:9530053A07Rik UTSW 7 28146906 missense probably damaging 1.00
R4460:9530053A07Rik UTSW 7 28152856 missense probably benign 0.17
R4463:9530053A07Rik UTSW 7 28150719 missense probably benign
R4841:9530053A07Rik UTSW 7 28150722 missense probably damaging 1.00
R4842:9530053A07Rik UTSW 7 28150722 missense probably damaging 1.00
R4876:9530053A07Rik UTSW 7 28142800 intron probably benign
R4905:9530053A07Rik UTSW 7 28156983 missense possibly damaging 0.93
R4997:9530053A07Rik UTSW 7 28143924 missense possibly damaging 0.77
R5091:9530053A07Rik UTSW 7 28156958 missense probably benign 0.44
R5159:9530053A07Rik UTSW 7 28153308 missense probably benign 0.09
R5326:9530053A07Rik UTSW 7 28155489 missense probably damaging 0.98
R5396:9530053A07Rik UTSW 7 28140183 missense probably benign
R5441:9530053A07Rik UTSW 7 28156914 missense probably damaging 1.00
R5480:9530053A07Rik UTSW 7 28157999 nonsense probably null
R5542:9530053A07Rik UTSW 7 28155489 missense probably damaging 0.98
R5571:9530053A07Rik UTSW 7 28156569 missense probably damaging 0.99
R5613:9530053A07Rik UTSW 7 28142878 intron probably benign
R5637:9530053A07Rik UTSW 7 28152852 missense probably benign 0.00
R5766:9530053A07Rik UTSW 7 28137329 nonsense probably null
R6174:9530053A07Rik UTSW 7 28139959 missense probably damaging 0.96
R6233:9530053A07Rik UTSW 7 28131460 missense probably damaging 0.99
R6250:9530053A07Rik UTSW 7 28150714 missense probably damaging 1.00
R6379:9530053A07Rik UTSW 7 28157592 missense probably damaging 1.00
R6442:9530053A07Rik UTSW 7 28144186 missense possibly damaging 0.88
R6478:9530053A07Rik UTSW 7 28155373 missense probably damaging 1.00
R6699:9530053A07Rik UTSW 7 28144368 missense probably damaging 1.00
R6852:9530053A07Rik UTSW 7 28147135 missense probably damaging 1.00
R6883:9530053A07Rik UTSW 7 28152835 missense possibly damaging 0.89
R6902:9530053A07Rik UTSW 7 28137213 missense probably damaging 1.00
R6903:9530053A07Rik UTSW 7 28137213 missense probably damaging 1.00
R6904:9530053A07Rik UTSW 7 28137213 missense probably damaging 1.00
R6992:9530053A07Rik UTSW 7 28140183 missense probably benign 0.04
R7039:9530053A07Rik UTSW 7 28140148 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- AGACCGACCAACTGCTCTTC -3'
(R):5'- CACTTTGAAGTCGGGGAGAG -3'

Sequencing Primer
(F):5'- TGCGTGTGCCTTCCAGG -3'
(R):5'- AGAGATGGGTGCTGGCCAC -3'
Posted On2019-05-13