Incidental Mutation 'R7023:Doc2g'
ID545812
Institutional Source Beutler Lab
Gene Symbol Doc2g
Ensembl Gene ENSMUSG00000024871
Gene Namedouble C2, gamma
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R7023 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location4003321-4007005 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4004778 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 220 (S220G)
Ref Sequence ENSEMBL: ENSMUSP00000025806 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025802] [ENSMUST00000025806] [ENSMUST00000042497] [ENSMUST00000122924] [ENSMUST00000128787] [ENSMUST00000129706] [ENSMUST00000133474] [ENSMUST00000134479] [ENSMUST00000136921] [ENSMUST00000155405]
Predicted Effect probably benign
Transcript: ENSMUST00000025802
SMART Domains Protein: ENSMUSP00000025802
Gene: ENSMUSG00000110949

DomainStartEndE-ValueType
Pfam:NUDIX 26 160 2.8e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000025806
AA Change: S220G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000025806
Gene: ENSMUSG00000024871
AA Change: S220G

DomainStartEndE-ValueType
C2 99 206 1.14e-10 SMART
low complexity region 231 243 N/A INTRINSIC
C2 259 373 5.14e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000042497
SMART Domains Protein: ENSMUSP00000042967
Gene: ENSMUSG00000037916

DomainStartEndE-ValueType
Pfam:Complex1_51K 80 252 2.4e-52 PFAM
Pfam:SLBB 275 327 5.1e-10 PFAM
NADH_4Fe-4S 364 409 1.05e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122924
SMART Domains Protein: ENSMUSP00000122531
Gene: ENSMUSG00000110949

DomainStartEndE-ValueType
Pfam:NUDIX 19 117 3.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128787
SMART Domains Protein: ENSMUSP00000123069
Gene: ENSMUSG00000037916

DomainStartEndE-ValueType
Pfam:Complex1_51K 71 243 1.6e-52 PFAM
Pfam:SLBB 266 318 8.6e-10 PFAM
NADH_4Fe-4S 355 400 1.05e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129706
SMART Domains Protein: ENSMUSP00000115653
Gene: ENSMUSG00000037916

DomainStartEndE-ValueType
Pfam:Complex1_51K 80 115 1.4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133474
SMART Domains Protein: ENSMUSP00000120223
Gene: ENSMUSG00000037916

DomainStartEndE-ValueType
Pfam:Complex1_51K 1 146 3.3e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134479
SMART Domains Protein: ENSMUSP00000121915
Gene: ENSMUSG00000037916

DomainStartEndE-ValueType
Pfam:Complex1_51K 1 173 3.6e-53 PFAM
Pfam:SLBB 196 248 5.2e-11 PFAM
NADH_4Fe-4S 285 330 1.05e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136921
SMART Domains Protein: ENSMUSP00000123680
Gene: ENSMUSG00000037916

DomainStartEndE-ValueType
Pfam:Complex1_51K 1 114 6.7e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155405
SMART Domains Protein: ENSMUSP00000119218
Gene: ENSMUSG00000024869

DomainStartEndE-ValueType
Pfam:NUDIX 29 159 8.1e-15 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik A G 13: 119,473,907 H372R probably benign Het
4933405O20Rik T C 7: 50,600,253 I345T probably damaging Het
4933427D14Rik A G 11: 72,178,403 probably null Het
6430548M08Rik T C 8: 120,145,357 V8A probably damaging Het
9530053A07Rik T A 7: 28,140,038 C425* probably null Het
Adam2 A T 14: 66,043,056 D501E probably benign Het
Agbl3 T C 6: 34,814,769 V602A probably benign Het
Akap12 T C 10: 4,356,895 M1235T probably benign Het
Arid5a G A 1: 36,317,550 probably benign Het
Asxl1 T A 2: 153,400,549 D1006E probably benign Het
AY074887 T C 9: 54,950,865 probably benign Het
Btbd9 T A 17: 30,527,572 R93S probably benign Het
Cabp2 A T 19: 4,082,658 probably null Het
Cacna1e T C 1: 154,725,693 D76G probably null Het
Cd177 A G 7: 24,759,762 I74T probably benign Het
Chchd1 G A 14: 20,703,242 probably benign Het
Col28a1 T C 6: 8,083,763 R565G possibly damaging Het
Cpvl T A 6: 53,967,812 I80F probably benign Het
Csgalnact1 T C 8: 68,358,429 T530A probably benign Het
Cybrd1 A G 2: 71,138,578 D265G probably benign Het
Cyp2c69 A T 19: 39,877,542 N202K probably benign Het
D1Pas1 A G 1: 186,968,008 N45D probably damaging Het
Dclre1a A G 19: 56,540,206 V839A probably damaging Het
Degs1 A T 1: 182,279,065 Y210N probably damaging Het
Epb41l2 T A 10: 25,512,977 L885Q probably damaging Het
Fabp1 A T 6: 71,203,085 probably null Het
Fat2 G A 11: 55,310,502 S582L probably benign Het
Fras1 A G 5: 96,710,084 N2079S probably benign Het
Gdf6 T C 4: 9,860,210 Y431H probably damaging Het
Gfra1 A T 19: 58,454,332 L6Q probably damaging Het
Gm45861 T G 8: 27,581,006 S1305A unknown Het
Gse1 T C 8: 120,230,648 probably benign Het
Kmt2e A G 5: 23,500,487 H1303R possibly damaging Het
Lck T C 4: 129,548,865 D499G possibly damaging Het
Lepr A T 4: 101,789,287 Y805F probably damaging Het
Lin7a A T 10: 107,382,628 Y11F possibly damaging Het
Lrrc43 A G 5: 123,503,763 K559E probably damaging Het
Megf6 T C 4: 154,254,145 L467P possibly damaging Het
Mprip G A 11: 59,737,389 G221R probably damaging Het
Myo5c T C 9: 75,301,456 V1683A probably damaging Het
Nbeal2 G A 9: 110,638,618 R501W probably damaging Het
Ncf1 G T 5: 134,225,262 A219E possibly damaging Het
Nckap1l T C 15: 103,476,066 I616T probably benign Het
Nlrp2 A T 7: 5,328,229 C389* probably null Het
Nrg3 T C 14: 38,376,376 E507G probably damaging Het
Olfr1180 A G 2: 88,412,415 L81P probably damaging Het
P4ha2 A T 11: 54,131,246 T532S probably benign Het
Pappa A T 4: 65,351,718 H1623L probably benign Het
Paqr6 A G 3: 88,366,046 Y115C probably damaging Het
Pcolce2 A T 9: 95,678,468 Q190L probably benign Het
Poll A G 19: 45,558,838 I65T probably benign Het
Prmt9 T C 8: 77,549,457 probably benign Het
Prpf39 T C 12: 65,053,300 V130A possibly damaging Het
Prpf6 A G 2: 181,620,640 D144G probably damaging Het
Rgs6 T A 12: 83,092,104 probably benign Het
Rimbp2 A G 5: 128,802,783 probably null Het
Ripor2 A G 13: 24,671,846 T90A probably benign Het
Rnf150 T C 8: 82,864,077 F23S probably damaging Het
Rpp40 G A 13: 35,898,906 R200W possibly damaging Het
Rtp3 G A 9: 110,986,646 S217L probably benign Het
Sacs A C 14: 61,208,815 K2770T probably benign Het
Scn10a A T 9: 119,613,544 I1545N probably damaging Het
Scn2b G T 9: 45,126,140 V162L probably damaging Het
Sema6d A G 2: 124,664,911 T880A probably damaging Het
Slc36a4 A G 9: 15,719,633 D16G probably benign Het
Slc4a8 T A 15: 100,791,643 I378K probably benign Het
Smco2 T A 6: 146,858,856 L70* probably null Het
Sptb C T 12: 76,625,088 V364I probably damaging Het
Susd4 A G 1: 182,765,048 H3R probably damaging Het
Tbc1d16 T C 11: 119,158,791 Q293R probably damaging Het
Tnfsf9 T A 17: 57,107,317 M248K possibly damaging Het
Toporsl A G 4: 52,611,211 N368S possibly damaging Het
Trip11 T C 12: 101,885,867 E361G probably benign Het
Trrap T A 5: 144,792,154 M626K possibly damaging Het
Ttn A T 2: 76,942,874 S2395T probably damaging Het
Ubqln3 T C 7: 104,141,423 R487G probably damaging Het
Vdac1 A G 11: 52,374,366 Y22C probably damaging Het
Vmn1r59 C T 7: 5,454,478 M94I probably benign Het
Vmn2r10 G T 5: 109,002,028 D383E probably damaging Het
Vmn2r115 T C 17: 23,359,811 Y753H probably damaging Het
Vmn2r97 G T 17: 18,914,401 C27F probably damaging Het
Wasf1 T A 10: 40,936,475 V420E unknown Het
Zfp94 A T 7: 24,303,396 L201Q probably damaging Het
Zgpat TGGAGGAGGAGGAGGAGGA TGGAGGAGGAGGAGGA 2: 181,366,018 probably benign Het
Zmym4 C A 4: 126,868,800 R1410L probably damaging Het
Other mutations in Doc2g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01110:Doc2g APN 19 4006577 missense probably damaging 1.00
IGL02952:Doc2g APN 19 4006719 missense possibly damaging 0.83
PIT4585001:Doc2g UTSW 19 4006630 missense probably benign 0.41
R0194:Doc2g UTSW 19 4003656 missense probably benign 0.00
R3813:Doc2g UTSW 19 4004466 unclassified probably null
R4508:Doc2g UTSW 19 4004036 splice site probably benign
Predicted Primers PCR Primer
(F):5'- CCAGGAGCTTTGACATCTGTC -3'
(R):5'- ATGAGTCACTGTCACCTCACC -3'

Sequencing Primer
(F):5'- GAGCTTTGACATCTGTCTAGAGAAGC -3'
(R):5'- AGTCCTGAGACCCTGGAAGTTG -3'
Posted On2019-05-13