Incidental Mutation 'R7026:Mroh9'
ID545943
Institutional Source Beutler Lab
Gene Symbol Mroh9
Ensembl Gene ENSMUSG00000071890
Gene Namemaestro heat-like repeat family member 9
Synonyms4921528O07Rik, Armc11
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7026 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location163024302-163085670 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 163060682 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 275 (M275L)
Ref Sequence ENSEMBL: ENSMUSP00000094365 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096608]
Predicted Effect probably benign
Transcript: ENSMUST00000096608
AA Change: M275L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000094365
Gene: ENSMUSG00000071890
AA Change: M275L

DomainStartEndE-ValueType
SCOP:d1gw5b_ 231 716 2e-8 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 99% (69/70)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 A T 19: 43,816,953 M749L probably benign Het
Abcc2 A G 19: 43,830,535 N1321S probably benign Het
Acsm2 T A 7: 119,592,227 V506E probably damaging Het
Add2 G A 6: 86,086,983 R88Q probably benign Het
Adgra3 A G 5: 49,960,741 V1155A probably benign Het
Ahsg T A 16: 22,892,213 D33E probably damaging Het
Alox12b A T 11: 69,157,305 D20V possibly damaging Het
Alppl2 A G 1: 87,089,698 probably null Het
Ankfn1 A G 11: 89,639,577 *49Q probably null Het
Bcl11b T C 12: 107,916,592 D488G probably damaging Het
Bcl2l10 T A 9: 75,351,082 F175L probably benign Het
C2cd3 T A 7: 100,432,092 D127E probably damaging Het
Cacna1c C T 6: 118,637,771 V1311I probably damaging Het
Cd55b A T 1: 130,388,690 I374K probably benign Het
Cfap36 T C 11: 29,222,565 T267A probably benign Het
Cog1 T C 11: 113,649,589 L10P probably damaging Het
Dnah7a T A 1: 53,504,289 M2241L probably benign Het
Dock10 G T 1: 80,501,787 A1809E probably benign Het
Dock7 A T 4: 99,078,919 D255E probably benign Het
Exph5 T C 9: 53,340,428 F123L probably benign Het
Fam92b G A 8: 120,168,585 H193Y probably damaging Het
Fbxw27 C A 9: 109,788,078 K118N possibly damaging Het
Fscb C A 12: 64,471,617 S1025I unknown Het
Get4 C T 5: 139,252,603 R47W possibly damaging Het
Gm14409 T A 2: 177,265,568 I46F probably benign Het
Gm3676 G A 14: 41,644,115 S81F probably benign Het
Gulp1 C T 1: 44,781,085 P251S possibly damaging Het
Hhatl T C 9: 121,788,273 D298G probably benign Het
Hsf2bp T A 17: 32,033,280 K60N possibly damaging Het
Ints4 T A 7: 97,519,154 V625D possibly damaging Het
Iqch T A 9: 63,525,139 K286* probably null Het
Irak1bp1 T A 9: 82,830,031 S2T possibly damaging Het
Kdm3b G A 18: 34,822,464 V1135I possibly damaging Het
Lama3 C A 18: 12,516,548 N181K probably damaging Het
Lrfn2 T G 17: 49,096,977 S709R probably benign Het
Lrp12 T C 15: 39,880,170 H123R probably damaging Het
Lrp1b A G 2: 41,269,222 S1569P probably damaging Het
Lrp2 T G 2: 69,521,787 Q635P probably damaging Het
Mboat2 T C 12: 24,948,382 probably null Het
Mctp1 A G 13: 76,806,259 T596A probably benign Het
Ms4a10 A C 19: 10,967,505 probably null Het
Myo9a C T 9: 59,815,334 R560C probably damaging Het
Olfr1348 T A 7: 6,501,821 H135L probably damaging Het
Olfr1461 A G 19: 13,165,415 T134A probably benign Het
Olfr747 A G 14: 50,681,259 I125T probably damaging Het
Ormdl3 A G 11: 98,583,982 V45A possibly damaging Het
Parp4 T C 14: 56,620,592 Y894H probably benign Het
Pigo G A 4: 43,023,380 Q259* probably null Het
Prrc2a G A 17: 35,161,827 P70S unknown Het
Rab3ip A G 10: 116,937,536 I124T probably benign Het
Rap1b A G 10: 117,818,479 I21T probably benign Het
Rasgrf2 T A 13: 91,983,613 S642C probably damaging Het
Rb1 T C 14: 73,298,099 E106G probably benign Het
Reps1 C A 10: 18,107,689 R427S probably damaging Het
Rnf213 A C 11: 119,479,655 H4760P possibly damaging Het
Rtl1 A G 12: 109,593,161 I748T probably damaging Het
Sco1 A T 11: 67,053,857 K102M probably damaging Het
Sec16b T C 1: 157,534,711 M44T possibly damaging Het
Slc7a10 T C 7: 35,198,714 M297T probably damaging Het
Smchd1 T C 17: 71,349,667 H1935R probably benign Het
Sowaha G A 11: 53,479,223 R229W probably damaging Het
Sptlc3 A T 2: 139,537,688 M83L probably benign Het
Tbc1d9 T C 8: 83,241,563 V431A probably benign Het
Tmem98 A G 11: 80,821,388 E217G possibly damaging Het
Trim13 T A 14: 61,605,113 L193* probably null Het
Trp53bp2 T C 1: 182,442,735 S367P probably benign Het
Tsc2 T G 17: 24,626,739 I202L probably damaging Het
Twf2 T A 9: 106,214,880 V312E probably damaging Het
Usp34 G T 11: 23,361,622 L471F probably damaging Het
Vps37c A G 19: 10,706,268 D18G probably damaging Het
Other mutations in Mroh9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00593:Mroh9 APN 1 163045781 missense possibly damaging 0.89
IGL00705:Mroh9 APN 1 163079503 missense probably damaging 1.00
IGL00788:Mroh9 APN 1 163024658 missense probably benign 0.06
IGL00795:Mroh9 APN 1 163060622 missense probably damaging 1.00
IGL00815:Mroh9 APN 1 163039131 missense probably damaging 1.00
IGL01025:Mroh9 APN 1 163047866 missense possibly damaging 0.67
IGL01303:Mroh9 APN 1 163080575 missense probably benign 0.00
IGL01526:Mroh9 APN 1 163055603 missense probably damaging 0.99
IGL01680:Mroh9 APN 1 163047982 splice site probably null
IGL01823:Mroh9 APN 1 163055609 missense probably benign 0.39
IGL02024:Mroh9 APN 1 163062502 missense possibly damaging 0.65
IGL02213:Mroh9 APN 1 163058079 missense probably damaging 1.00
IGL02455:Mroh9 APN 1 163075580 missense probably benign 0.03
IGL02546:Mroh9 APN 1 163080576 missense probably benign 0.04
IGL03059:Mroh9 APN 1 163024636 missense possibly damaging 0.95
IGL03061:Mroh9 APN 1 163026502 missense probably damaging 1.00
IGL03071:Mroh9 APN 1 163039197 missense probably damaging 1.00
R0048:Mroh9 UTSW 1 163062487 missense probably damaging 0.97
R0048:Mroh9 UTSW 1 163062487 missense probably damaging 0.97
R0441:Mroh9 UTSW 1 163060762 missense probably damaging 1.00
R0506:Mroh9 UTSW 1 163060636 missense possibly damaging 0.90
R0629:Mroh9 UTSW 1 163060636 missense possibly damaging 0.90
R0751:Mroh9 UTSW 1 163066124 missense possibly damaging 0.84
R1301:Mroh9 UTSW 1 163043983 critical splice donor site probably null
R1481:Mroh9 UTSW 1 163026509 missense probably damaging 1.00
R1618:Mroh9 UTSW 1 163024541 missense probably benign 0.00
R1647:Mroh9 UTSW 1 163046056 missense probably damaging 1.00
R1648:Mroh9 UTSW 1 163046056 missense probably damaging 1.00
R1668:Mroh9 UTSW 1 163024592 missense possibly damaging 0.52
R1795:Mroh9 UTSW 1 163056778 missense probably damaging 0.97
R1796:Mroh9 UTSW 1 163045710 missense probably damaging 1.00
R1857:Mroh9 UTSW 1 163039145 missense probably damaging 0.98
R1869:Mroh9 UTSW 1 163026513 missense probably damaging 0.97
R1923:Mroh9 UTSW 1 163076291 missense probably damaging 1.00
R2325:Mroh9 UTSW 1 163026530 splice site probably null
R2511:Mroh9 UTSW 1 163038945 missense probably benign 0.13
R2912:Mroh9 UTSW 1 163044003 missense probably damaging 1.00
R2913:Mroh9 UTSW 1 163044003 missense probably damaging 1.00
R2919:Mroh9 UTSW 1 163056772 missense probably damaging 1.00
R2973:Mroh9 UTSW 1 163056769 missense probably damaging 1.00
R3912:Mroh9 UTSW 1 163066069 missense probably damaging 0.97
R4034:Mroh9 UTSW 1 163080553 critical splice donor site probably null
R4551:Mroh9 UTSW 1 163044093 missense probably damaging 0.98
R4656:Mroh9 UTSW 1 163066024 missense probably damaging 1.00
R4662:Mroh9 UTSW 1 163055593 missense probably damaging 0.97
R4743:Mroh9 UTSW 1 163024492 missense probably benign 0.05
R4890:Mroh9 UTSW 1 163026524 missense probably damaging 1.00
R5128:Mroh9 UTSW 1 163060760 missense probably damaging 1.00
R5129:Mroh9 UTSW 1 163060760 missense probably damaging 1.00
R5147:Mroh9 UTSW 1 163060760 missense probably damaging 1.00
R5157:Mroh9 UTSW 1 163044121 missense probably damaging 0.96
R5324:Mroh9 UTSW 1 163060760 missense probably damaging 1.00
R5325:Mroh9 UTSW 1 163060760 missense probably damaging 1.00
R5340:Mroh9 UTSW 1 163080587 start gained probably benign
R6005:Mroh9 UTSW 1 163075677 missense probably damaging 0.99
R6182:Mroh9 UTSW 1 163066043 nonsense probably null
R6414:Mroh9 UTSW 1 163074702 missense probably damaging 1.00
R6477:Mroh9 UTSW 1 163076304 missense probably damaging 1.00
R6540:Mroh9 UTSW 1 163038972 missense possibly damaging 0.87
R6541:Mroh9 UTSW 1 163058038 missense possibly damaging 0.78
R6643:Mroh9 UTSW 1 163075561 missense probably damaging 1.00
R6811:Mroh9 UTSW 1 163046041 missense possibly damaging 0.86
R6830:Mroh9 UTSW 1 163076366 missense probably benign
R7052:Mroh9 UTSW 1 163038956 missense possibly damaging 0.92
R7068:Mroh9 UTSW 1 163039181 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTCTTCTGATTAAAGTGACTCAG -3'
(R):5'- TGGAACTTCCATCATCATTGCAC -3'

Sequencing Primer
(F):5'- CTGATTAAAGTGACTCAGGGAATAAG -3'
(R):5'- GTAGAGAAAACAGCTTCCATAGTTC -3'
Posted On2019-05-13