Incidental Mutation 'R7026:Dock7'
ID545950
Institutional Source Beutler Lab
Gene Symbol Dock7
Ensembl Gene ENSMUSG00000028556
Gene Namededicator of cytokinesis 7
Synonyms3110056M06Rik, m, LOC242555
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7026 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location98936671-99120915 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 99078919 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 255 (D255E)
Ref Sequence ENSEMBL: ENSMUSP00000145604 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030286] [ENSMUST00000075836] [ENSMUST00000127417] [ENSMUST00000205650]
Predicted Effect probably benign
Transcript: ENSMUST00000030286
AA Change: D255E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000030286
Gene: ENSMUSG00000028556
AA Change: D255E

DomainStartEndE-ValueType
Pfam:DUF3398 67 159 6.5e-30 PFAM
coiled coil region 367 394 N/A INTRINSIC
low complexity region 493 504 N/A INTRINSIC
Pfam:DOCK-C2 557 736 1.8e-51 PFAM
low complexity region 789 799 N/A INTRINSIC
low complexity region 862 873 N/A INTRINSIC
low complexity region 888 901 N/A INTRINSIC
low complexity region 1135 1163 N/A INTRINSIC
low complexity region 1350 1364 N/A INTRINSIC
low complexity region 1543 1565 N/A INTRINSIC
Pfam:DHR-2 1571 2095 1.4e-217 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000075233
Gene: ENSMUSG00000028556
AA Change: D255E

DomainStartEndE-ValueType
Pfam:DUF3398 65 159 5.8e-34 PFAM
coiled coil region 367 394 N/A INTRINSIC
low complexity region 493 504 N/A INTRINSIC
Pfam:DOCK-C2 556 737 3.3e-58 PFAM
low complexity region 789 799 N/A INTRINSIC
low complexity region 862 873 N/A INTRINSIC
low complexity region 888 901 N/A INTRINSIC
low complexity region 1105 1133 N/A INTRINSIC
low complexity region 1320 1334 N/A INTRINSIC
low complexity region 1513 1535 N/A INTRINSIC
Pfam:Ded_cyto 1888 2065 6.5e-80 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000117797
Gene: ENSMUSG00000028556
AA Change: D255E

DomainStartEndE-ValueType
low complexity region 140 162 N/A INTRINSIC
Pfam:Ded_cyto 517 694 3e-80 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205650
AA Change: D255E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a guanine nucleotide exchange factor (GEF) that plays a role in axon formation and neuronal polarization. The encoded protein displays GEF activity toward RAC1 and RAC3 Rho small GTPases but not toward CDC42. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for mutations of this gene exhibit coat color dilution, white tail tip, and on some genetic backgrounds a white belly spot. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 A T 19: 43,816,953 M749L probably benign Het
Abcc2 A G 19: 43,830,535 N1321S probably benign Het
Acsm2 T A 7: 119,592,227 V506E probably damaging Het
Add2 G A 6: 86,086,983 R88Q probably benign Het
Adgra3 A G 5: 49,960,741 V1155A probably benign Het
Ahsg T A 16: 22,892,213 D33E probably damaging Het
Alox12b A T 11: 69,157,305 D20V possibly damaging Het
Alppl2 A G 1: 87,089,698 probably null Het
Ankfn1 A G 11: 89,639,577 *49Q probably null Het
Bcl11b T C 12: 107,916,592 D488G probably damaging Het
Bcl2l10 T A 9: 75,351,082 F175L probably benign Het
C2cd3 T A 7: 100,432,092 D127E probably damaging Het
Cacna1c C T 6: 118,637,771 V1311I probably damaging Het
Cd55b A T 1: 130,388,690 I374K probably benign Het
Cfap36 T C 11: 29,222,565 T267A probably benign Het
Cog1 T C 11: 113,649,589 L10P probably damaging Het
Dnah7a T A 1: 53,504,289 M2241L probably benign Het
Dock10 G T 1: 80,501,787 A1809E probably benign Het
Exph5 T C 9: 53,340,428 F123L probably benign Het
Fam92b G A 8: 120,168,585 H193Y probably damaging Het
Fbxw27 C A 9: 109,788,078 K118N possibly damaging Het
Fscb C A 12: 64,471,617 S1025I unknown Het
Get4 C T 5: 139,252,603 R47W possibly damaging Het
Gm14409 T A 2: 177,265,568 I46F probably benign Het
Gm3676 G A 14: 41,644,115 S81F probably benign Het
Gulp1 C T 1: 44,781,085 P251S possibly damaging Het
Hhatl T C 9: 121,788,273 D298G probably benign Het
Hsf2bp T A 17: 32,033,280 K60N possibly damaging Het
Ints4 T A 7: 97,519,154 V625D possibly damaging Het
Iqch T A 9: 63,525,139 K286* probably null Het
Irak1bp1 T A 9: 82,830,031 S2T possibly damaging Het
Kdm3b G A 18: 34,822,464 V1135I possibly damaging Het
Lama3 C A 18: 12,516,548 N181K probably damaging Het
Lrfn2 T G 17: 49,096,977 S709R probably benign Het
Lrp12 T C 15: 39,880,170 H123R probably damaging Het
Lrp1b A G 2: 41,269,222 S1569P probably damaging Het
Lrp2 T G 2: 69,521,787 Q635P probably damaging Het
Mboat2 T C 12: 24,948,382 probably null Het
Mctp1 A G 13: 76,806,259 T596A probably benign Het
Mroh9 T A 1: 163,060,682 M275L probably benign Het
Ms4a10 A C 19: 10,967,505 probably null Het
Myo9a C T 9: 59,815,334 R560C probably damaging Het
Olfr1348 T A 7: 6,501,821 H135L probably damaging Het
Olfr1461 A G 19: 13,165,415 T134A probably benign Het
Olfr747 A G 14: 50,681,259 I125T probably damaging Het
Ormdl3 A G 11: 98,583,982 V45A possibly damaging Het
Parp4 T C 14: 56,620,592 Y894H probably benign Het
Pigo G A 4: 43,023,380 Q259* probably null Het
Prrc2a G A 17: 35,161,827 P70S unknown Het
Rab3ip A G 10: 116,937,536 I124T probably benign Het
Rap1b A G 10: 117,818,479 I21T probably benign Het
Rasgrf2 T A 13: 91,983,613 S642C probably damaging Het
Rb1 T C 14: 73,298,099 E106G probably benign Het
Reps1 C A 10: 18,107,689 R427S probably damaging Het
Rnf213 A C 11: 119,479,655 H4760P possibly damaging Het
Rtl1 A G 12: 109,593,161 I748T probably damaging Het
Sco1 A T 11: 67,053,857 K102M probably damaging Het
Sec16b T C 1: 157,534,711 M44T possibly damaging Het
Slc7a10 T C 7: 35,198,714 M297T probably damaging Het
Smchd1 T C 17: 71,349,667 H1935R probably benign Het
Sowaha G A 11: 53,479,223 R229W probably damaging Het
Sptlc3 A T 2: 139,537,688 M83L probably benign Het
Tbc1d9 T C 8: 83,241,563 V431A probably benign Het
Tmem98 A G 11: 80,821,388 E217G possibly damaging Het
Trim13 T A 14: 61,605,113 L193* probably null Het
Trp53bp2 T C 1: 182,442,735 S367P probably benign Het
Tsc2 T G 17: 24,626,739 I202L probably damaging Het
Twf2 T A 9: 106,214,880 V312E probably damaging Het
Usp34 G T 11: 23,361,622 L471F probably damaging Het
Vps37c A G 19: 10,706,268 D18G probably damaging Het
Other mutations in Dock7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Dock7 APN 4 99063985 missense probably damaging 1.00
IGL01126:Dock7 APN 4 98973552 splice site probably benign
IGL01490:Dock7 APN 4 98945118 unclassified probably benign
IGL01553:Dock7 APN 4 98945566 nonsense probably null
IGL01728:Dock7 APN 4 98962331 missense probably damaging 1.00
IGL01776:Dock7 APN 4 98940941 missense possibly damaging 0.65
IGL01954:Dock7 APN 4 99083151 missense probably damaging 0.99
IGL01985:Dock7 APN 4 99023377 missense probably benign 0.35
IGL02054:Dock7 APN 4 98973409 missense probably damaging 1.00
IGL02150:Dock7 APN 4 99079852 splice site probably benign
IGL02153:Dock7 APN 4 98958067 missense probably benign 0.15
IGL02183:Dock7 APN 4 98958991 missense possibly damaging 0.89
IGL02494:Dock7 APN 4 98989234 missense probably benign 0.18
IGL02618:Dock7 APN 4 99083028 missense probably benign 0.00
IGL02634:Dock7 APN 4 98989296 missense probably damaging 1.00
IGL02670:Dock7 APN 4 98966286 splice site probably null
IGL02690:Dock7 APN 4 98969635 missense possibly damaging 0.95
IGL02692:Dock7 APN 4 98987386 missense probably damaging 1.00
IGL02833:Dock7 APN 4 98945495 missense probably damaging 1.00
IGL02858:Dock7 APN 4 98945205 nonsense probably null
IGL02875:Dock7 APN 4 98975994 missense probably benign 0.00
IGL03027:Dock7 APN 4 98977927 missense probably benign
IGL03027:Dock7 APN 4 99070213 missense possibly damaging 0.71
IGL03032:Dock7 APN 4 98966348 missense probably benign 0.02
IGL03104:Dock7 APN 4 98959023 missense possibly damaging 0.60
IGL03136:Dock7 APN 4 99003791 missense probably damaging 1.00
IGL03345:Dock7 APN 4 98984819 missense possibly damaging 0.91
moonlight UTSW 4 large deletion
PIT4810001:Dock7 UTSW 4 98945559 nonsense probably null
R0086:Dock7 UTSW 4 98945144 missense probably damaging 1.00
R0242:Dock7 UTSW 4 98962280 missense probably benign
R0242:Dock7 UTSW 4 98962280 missense probably benign
R0245:Dock7 UTSW 4 99055349 missense possibly damaging 0.64
R0308:Dock7 UTSW 4 98984814 missense probably benign 0.07
R0556:Dock7 UTSW 4 98945189 missense probably damaging 1.00
R0612:Dock7 UTSW 4 98989233 missense probably benign 0.31
R0652:Dock7 UTSW 4 99055349 missense possibly damaging 0.64
R0669:Dock7 UTSW 4 98987479 missense probably benign 0.00
R0681:Dock7 UTSW 4 99016704 missense probably damaging 1.00
R0725:Dock7 UTSW 4 98945291 missense probably damaging 1.00
R0828:Dock7 UTSW 4 99015745 missense probably damaging 1.00
R0837:Dock7 UTSW 4 98989258 missense probably benign 0.01
R0962:Dock7 UTSW 4 98945195 missense possibly damaging 0.85
R1140:Dock7 UTSW 4 99065406 missense possibly damaging 0.82
R1476:Dock7 UTSW 4 99079435 missense possibly damaging 0.52
R1614:Dock7 UTSW 4 99061280 missense probably benign 0.12
R1625:Dock7 UTSW 4 98962196 splice site probably null
R1640:Dock7 UTSW 4 98945246 missense probably damaging 1.00
R1752:Dock7 UTSW 4 98966444 missense probably damaging 1.00
R1941:Dock7 UTSW 4 98984715 missense probably benign 0.09
R2020:Dock7 UTSW 4 98959101 missense probably damaging 1.00
R2092:Dock7 UTSW 4 99009308 missense possibly damaging 0.95
R2293:Dock7 UTSW 4 98966369 missense probably damaging 1.00
R2424:Dock7 UTSW 4 98945307 nonsense probably null
R3767:Dock7 UTSW 4 98970829 missense probably benign
R3768:Dock7 UTSW 4 98970829 missense probably benign
R3769:Dock7 UTSW 4 98970829 missense probably benign
R3770:Dock7 UTSW 4 98970829 missense probably benign
R3917:Dock7 UTSW 4 99016685 missense probably damaging 1.00
R3943:Dock7 UTSW 4 98992431 missense probably damaging 1.00
R4021:Dock7 UTSW 4 99003920 splice site probably null
R4073:Dock7 UTSW 4 99008059 missense probably benign 0.02
R4170:Dock7 UTSW 4 98966401 missense probably damaging 0.99
R4180:Dock7 UTSW 4 99016736 missense probably benign 0.05
R4261:Dock7 UTSW 4 99003886 missense possibly damaging 0.78
R4321:Dock7 UTSW 4 99072454 missense probably damaging 1.00
R4522:Dock7 UTSW 4 98962224 missense probably damaging 1.00
R4582:Dock7 UTSW 4 99003916 missense possibly damaging 0.90
R4648:Dock7 UTSW 4 98969644 nonsense probably null
R4940:Dock7 UTSW 4 99020077 missense probably damaging 1.00
R5090:Dock7 UTSW 4 98991411 missense probably benign 0.04
R5374:Dock7 UTSW 4 98989038 missense possibly damaging 0.81
R5392:Dock7 UTSW 4 99008006 missense probably damaging 1.00
R5527:Dock7 UTSW 4 98953868 intron probably benign
R5544:Dock7 UTSW 4 98967257 missense probably damaging 1.00
R5556:Dock7 UTSW 4 98944735 missense probably damaging 1.00
R5870:Dock7 UTSW 4 99063962 missense probably benign 0.00
R5899:Dock7 UTSW 4 98991423 missense probably benign
R6360:Dock7 UTSW 4 98969662 missense probably benign 0.02
R6415:Dock7 UTSW 4 98992448 missense probably damaging 1.00
R6468:Dock7 UTSW 4 98967227 missense probably benign 0.15
R6562:Dock7 UTSW 4 98991410 missense probably damaging 0.97
R6613:Dock7 UTSW 4 98977960 missense probably damaging 0.99
R6703:Dock7 UTSW 4 98946672 missense probably damaging 1.00
R6723:Dock7 UTSW 4 99003916 missense possibly damaging 0.90
R6786:Dock7 UTSW 4 99061292 missense probably benign 0.42
R7051:Dock7 UTSW 4 98946732 missense probably damaging 1.00
R7074:Dock7 UTSW 4 98945208 missense unknown
R7106:Dock7 UTSW 4 98967326 missense unknown
R7147:Dock7 UTSW 4 98961417 missense unknown
R7257:Dock7 UTSW 4 98973412 missense unknown
X0027:Dock7 UTSW 4 99003853 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGGAAGTATTATGTGGGAAGCATTAAC -3'
(R):5'- TGAGGAACGTCTGTGACTGAG -3'

Sequencing Primer
(F):5'- TCAAAGCATTAGCCCAGG -3'
(R):5'- GAACGTCTGTGACTGAGTATACATGC -3'
Posted On2019-05-13