Incidental Mutation 'R7026:Get4'
ID545952
Institutional Source Beutler Lab
Gene Symbol Get4
Ensembl Gene ENSMUSG00000025858
Gene Namegolgi to ER traffic protein 4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7026 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location139252324-139270051 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 139252603 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 47 (R47W)
Ref Sequence ENSEMBL: ENSMUSP00000026976 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026976] [ENSMUST00000058716] [ENSMUST00000078690] [ENSMUST00000110878] [ENSMUST00000110882] [ENSMUST00000110883] [ENSMUST00000110884] [ENSMUST00000130326] [ENSMUST00000138508]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026976
AA Change: R47W

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000026976
Gene: ENSMUSG00000025858
AA Change: R47W

DomainStartEndE-ValueType
low complexity region 1 8 N/A INTRINSIC
low complexity region 12 22 N/A INTRINSIC
Pfam:DUF410 56 306 4.6e-79 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000058716
SMART Domains Protein: ENSMUSP00000056655
Gene: ENSMUSG00000036817

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 152 162 N/A INTRINSIC
ZnF_C2H2 183 205 5.2e0 SMART
SCOP:d1qovm1 334 450 2e-3 SMART
low complexity region 466 475 N/A INTRINSIC
coiled coil region 492 527 N/A INTRINSIC
SCOP:d1eq1a_ 572 689 3e-3 SMART
Pfam:Sad1_UNC 777 911 2.2e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000078690
SMART Domains Protein: ENSMUSP00000077756
Gene: ENSMUSG00000036817

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 152 162 N/A INTRINSIC
ZnF_C2H2 183 205 5.2e0 SMART
SCOP:d1qovm1 270 386 2e-3 SMART
low complexity region 402 411 N/A INTRINSIC
coiled coil region 428 463 N/A INTRINSIC
SCOP:d1eq1a_ 508 625 2e-3 SMART
Pfam:Sad1_UNC 713 847 1.9e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110878
SMART Domains Protein: ENSMUSP00000106502
Gene: ENSMUSG00000025858

DomainStartEndE-ValueType
Pfam:DUF410 1 250 2.6e-108 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110882
SMART Domains Protein: ENSMUSP00000106506
Gene: ENSMUSG00000036817

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 152 162 N/A INTRINSIC
ZnF_C2H2 183 205 5.2e0 SMART
low complexity region 263 271 N/A INTRINSIC
low complexity region 310 319 N/A INTRINSIC
coiled coil region 336 371 N/A INTRINSIC
SCOP:d1eq1a_ 416 533 4e-3 SMART
Pfam:Sad1_UNC 621 755 7.1e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110883
SMART Domains Protein: ENSMUSP00000106507
Gene: ENSMUSG00000036817

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 152 162 N/A INTRINSIC
ZnF_C2H2 183 205 5.2e0 SMART
SCOP:d1qovm1 233 327 4e-3 SMART
low complexity region 343 352 N/A INTRINSIC
coiled coil region 369 404 N/A INTRINSIC
SCOP:d1eq1a_ 449 566 3e-3 SMART
Pfam:Sad1_UNC 654 788 1.7e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110884
SMART Domains Protein: ENSMUSP00000106508
Gene: ENSMUSG00000036817

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 152 162 N/A INTRINSIC
ZnF_C2H2 183 205 5.2e0 SMART
Pfam:MRP 274 381 1.8e-8 PFAM
low complexity region 382 390 N/A INTRINSIC
low complexity region 429 438 N/A INTRINSIC
coiled coil region 455 490 N/A INTRINSIC
SCOP:d1eq1a_ 535 652 4e-3 SMART
Pfam:Sad1_UNC 740 874 2e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127310
SMART Domains Protein: ENSMUSP00000114514
Gene: ENSMUSG00000036817

DomainStartEndE-ValueType
low complexity region 1 11 N/A INTRINSIC
PDB:4DXS|A 38 73 3e-6 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000130326
AA Change: R47W

PolyPhen 2 Score 0.825 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000117473
Gene: ENSMUSG00000025858
AA Change: R47W

DomainStartEndE-ValueType
low complexity region 1 8 N/A INTRINSIC
low complexity region 12 22 N/A INTRINSIC
Pfam:DUF410 54 246 1.1e-80 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138508
SMART Domains Protein: ENSMUSP00000116975
Gene: ENSMUSG00000025858

DomainStartEndE-ValueType
Pfam:DUF410 1 197 4.5e-82 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 99% (69/70)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 A T 19: 43,816,953 M749L probably benign Het
Abcc2 A G 19: 43,830,535 N1321S probably benign Het
Acsm2 T A 7: 119,592,227 V506E probably damaging Het
Add2 G A 6: 86,086,983 R88Q probably benign Het
Adgra3 A G 5: 49,960,741 V1155A probably benign Het
Ahsg T A 16: 22,892,213 D33E probably damaging Het
Alox12b A T 11: 69,157,305 D20V possibly damaging Het
Alppl2 A G 1: 87,089,698 probably null Het
Ankfn1 A G 11: 89,639,577 *49Q probably null Het
Bcl11b T C 12: 107,916,592 D488G probably damaging Het
Bcl2l10 T A 9: 75,351,082 F175L probably benign Het
C2cd3 T A 7: 100,432,092 D127E probably damaging Het
Cacna1c C T 6: 118,637,771 V1311I probably damaging Het
Cd55b A T 1: 130,388,690 I374K probably benign Het
Cfap36 T C 11: 29,222,565 T267A probably benign Het
Cog1 T C 11: 113,649,589 L10P probably damaging Het
Dnah7a T A 1: 53,504,289 M2241L probably benign Het
Dock10 G T 1: 80,501,787 A1809E probably benign Het
Dock7 A T 4: 99,078,919 D255E probably benign Het
Exph5 T C 9: 53,340,428 F123L probably benign Het
Fam92b G A 8: 120,168,585 H193Y probably damaging Het
Fbxw27 C A 9: 109,788,078 K118N possibly damaging Het
Fscb C A 12: 64,471,617 S1025I unknown Het
Gm14409 T A 2: 177,265,568 I46F probably benign Het
Gm3676 G A 14: 41,644,115 S81F probably benign Het
Gulp1 C T 1: 44,781,085 P251S possibly damaging Het
Hhatl T C 9: 121,788,273 D298G probably benign Het
Hsf2bp T A 17: 32,033,280 K60N possibly damaging Het
Ints4 T A 7: 97,519,154 V625D possibly damaging Het
Iqch T A 9: 63,525,139 K286* probably null Het
Irak1bp1 T A 9: 82,830,031 S2T possibly damaging Het
Kdm3b G A 18: 34,822,464 V1135I possibly damaging Het
Lama3 C A 18: 12,516,548 N181K probably damaging Het
Lrfn2 T G 17: 49,096,977 S709R probably benign Het
Lrp12 T C 15: 39,880,170 H123R probably damaging Het
Lrp1b A G 2: 41,269,222 S1569P probably damaging Het
Lrp2 T G 2: 69,521,787 Q635P probably damaging Het
Mboat2 T C 12: 24,948,382 probably null Het
Mctp1 A G 13: 76,806,259 T596A probably benign Het
Mroh9 T A 1: 163,060,682 M275L probably benign Het
Ms4a10 A C 19: 10,967,505 probably null Het
Myo9a C T 9: 59,815,334 R560C probably damaging Het
Olfr1348 T A 7: 6,501,821 H135L probably damaging Het
Olfr1461 A G 19: 13,165,415 T134A probably benign Het
Olfr747 A G 14: 50,681,259 I125T probably damaging Het
Ormdl3 A G 11: 98,583,982 V45A possibly damaging Het
Parp4 T C 14: 56,620,592 Y894H probably benign Het
Pigo G A 4: 43,023,380 Q259* probably null Het
Prrc2a G A 17: 35,161,827 P70S unknown Het
Rab3ip A G 10: 116,937,536 I124T probably benign Het
Rap1b A G 10: 117,818,479 I21T probably benign Het
Rasgrf2 T A 13: 91,983,613 S642C probably damaging Het
Rb1 T C 14: 73,298,099 E106G probably benign Het
Reps1 C A 10: 18,107,689 R427S probably damaging Het
Rnf213 A C 11: 119,479,655 H4760P possibly damaging Het
Rtl1 A G 12: 109,593,161 I748T probably damaging Het
Sco1 A T 11: 67,053,857 K102M probably damaging Het
Sec16b T C 1: 157,534,711 M44T possibly damaging Het
Slc7a10 T C 7: 35,198,714 M297T probably damaging Het
Smchd1 T C 17: 71,349,667 H1935R probably benign Het
Sowaha G A 11: 53,479,223 R229W probably damaging Het
Sptlc3 A T 2: 139,537,688 M83L probably benign Het
Tbc1d9 T C 8: 83,241,563 V431A probably benign Het
Tmem98 A G 11: 80,821,388 E217G possibly damaging Het
Trim13 T A 14: 61,605,113 L193* probably null Het
Trp53bp2 T C 1: 182,442,735 S367P probably benign Het
Tsc2 T G 17: 24,626,739 I202L probably damaging Het
Twf2 T A 9: 106,214,880 V312E probably damaging Het
Usp34 G T 11: 23,361,622 L471F probably damaging Het
Vps37c A G 19: 10,706,268 D18G probably damaging Het
Other mutations in Get4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01064:Get4 APN 5 139252522 missense probably damaging 0.99
IGL02219:Get4 APN 5 139263629 critical splice donor site probably null
IGL02348:Get4 APN 5 139252499 missense probably benign 0.13
R0741:Get4 UTSW 5 139263629 critical splice donor site probably benign
R3805:Get4 UTSW 5 139252531 missense probably damaging 0.98
R3807:Get4 UTSW 5 139252531 missense probably damaging 0.98
R6609:Get4 UTSW 5 139269065 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GTTCTCAGGGTCCTTCTCAGAC -3'
(R):5'- TCTGAGAGTAAGGCAGGGACTC -3'

Sequencing Primer
(F):5'- CCACCGTAGAAGGAGTGC -3'
(R):5'- CTCAGAAAGACGAGGCCG -3'
Posted On2019-05-13