Incidental Mutation 'R7026:Slc7a10'
ID545956
Institutional Source Beutler Lab
Gene Symbol Slc7a10
Ensembl Gene ENSMUSG00000030495
Gene Namesolute carrier family 7 (cationic amino acid transporter, y+ system), member 10
SynonymsD7Bwg0847e, Asc-1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R7026 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location35186385-35201114 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 35198714 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 297 (M297T)
Ref Sequence ENSEMBL: ENSMUSP00000001854 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001854] [ENSMUST00000118444] [ENSMUST00000122409] [ENSMUST00000131048] [ENSMUST00000135452] [ENSMUST00000167441]
Predicted Effect probably damaging
Transcript: ENSMUST00000001854
AA Change: M297T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000001854
Gene: ENSMUSG00000030495
AA Change: M297T

DomainStartEndE-ValueType
low complexity region 14 37 N/A INTRINSIC
Pfam:AA_permease_2 46 474 4.8e-65 PFAM
Pfam:AA_permease 51 467 9.3e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118444
SMART Domains Protein: ENSMUSP00000113406
Gene: ENSMUSG00000001802

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
CUB 43 159 9.97e-20 SMART
LDLa 165 202 7.21e-11 SMART
LDLa 211 251 1.37e-11 SMART
CUB 254 365 1.98e-3 SMART
LDLa 367 414 1.85e-1 SMART
LDLa 415 453 4.44e-3 SMART
LDLa 454 490 8.74e-10 SMART
transmembrane domain 497 519 N/A INTRINSIC
low complexity region 584 606 N/A INTRINSIC
low complexity region 641 652 N/A INTRINSIC
low complexity region 674 684 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122409
SMART Domains Protein: ENSMUSP00000114026
Gene: ENSMUSG00000001802

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
CUB 64 180 9.97e-20 SMART
LDLa 186 223 7.21e-11 SMART
LDLa 232 272 1.37e-11 SMART
CUB 275 386 1.98e-3 SMART
LDLa 388 435 1.85e-1 SMART
LDLa 436 474 4.44e-3 SMART
LDLa 475 511 8.74e-10 SMART
transmembrane domain 518 540 N/A INTRINSIC
low complexity region 605 627 N/A INTRINSIC
low complexity region 662 673 N/A INTRINSIC
low complexity region 695 705 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000131048
AA Change: M297T

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000118331
Gene: ENSMUSG00000030495
AA Change: M297T

DomainStartEndE-ValueType
low complexity region 14 37 N/A INTRINSIC
Pfam:AA_permease_2 46 346 8.6e-48 PFAM
Pfam:AA_permease 51 346 1e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135452
SMART Domains Protein: ENSMUSP00000127577
Gene: ENSMUSG00000030495

DomainStartEndE-ValueType
low complexity region 14 37 N/A INTRINSIC
Pfam:AA_permease_2 46 125 1.5e-15 PFAM
Pfam:AA_permease 51 125 3.9e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146959
Predicted Effect probably benign
Transcript: ENSMUST00000167441
SMART Domains Protein: ENSMUSP00000129954
Gene: ENSMUSG00000030495

DomainStartEndE-ValueType
low complexity region 14 37 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC7A10, in association with 4F2HC (SLC3A2; MIM 158070), mediates high-affinity transport of D-serine and several other neutral amino acids (Nakauchi et al., 2000 [PubMed 10863037]).[supplied by OMIM, Mar 2008]
PHENOTYPE: A targeted mutation of this gene results in mice that develop tremors, ataxia and seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 A T 19: 43,816,953 M749L probably benign Het
Abcc2 A G 19: 43,830,535 N1321S probably benign Het
Acsm2 T A 7: 119,592,227 V506E probably damaging Het
Add2 G A 6: 86,086,983 R88Q probably benign Het
Adgra3 A G 5: 49,960,741 V1155A probably benign Het
Ahsg T A 16: 22,892,213 D33E probably damaging Het
Alox12b A T 11: 69,157,305 D20V possibly damaging Het
Alppl2 A G 1: 87,089,698 probably null Het
Ankfn1 A G 11: 89,639,577 *49Q probably null Het
Bcl11b T C 12: 107,916,592 D488G probably damaging Het
Bcl2l10 T A 9: 75,351,082 F175L probably benign Het
C2cd3 T A 7: 100,432,092 D127E probably damaging Het
Cacna1c C T 6: 118,637,771 V1311I probably damaging Het
Cd55b A T 1: 130,388,690 I374K probably benign Het
Cfap36 T C 11: 29,222,565 T267A probably benign Het
Cog1 T C 11: 113,649,589 L10P probably damaging Het
Dnah7a T A 1: 53,504,289 M2241L probably benign Het
Dock10 G T 1: 80,501,787 A1809E probably benign Het
Dock7 A T 4: 99,078,919 D255E probably benign Het
Exph5 T C 9: 53,340,428 F123L probably benign Het
Fam92b G A 8: 120,168,585 H193Y probably damaging Het
Fbxw27 C A 9: 109,788,078 K118N possibly damaging Het
Fscb C A 12: 64,471,617 S1025I unknown Het
Get4 C T 5: 139,252,603 R47W possibly damaging Het
Gm14409 T A 2: 177,265,568 I46F probably benign Het
Gm3676 G A 14: 41,644,115 S81F probably benign Het
Gulp1 C T 1: 44,781,085 P251S possibly damaging Het
Hhatl T C 9: 121,788,273 D298G probably benign Het
Hsf2bp T A 17: 32,033,280 K60N possibly damaging Het
Ints4 T A 7: 97,519,154 V625D possibly damaging Het
Iqch T A 9: 63,525,139 K286* probably null Het
Irak1bp1 T A 9: 82,830,031 S2T possibly damaging Het
Kdm3b G A 18: 34,822,464 V1135I possibly damaging Het
Lama3 C A 18: 12,516,548 N181K probably damaging Het
Lrfn2 T G 17: 49,096,977 S709R probably benign Het
Lrp12 T C 15: 39,880,170 H123R probably damaging Het
Lrp1b A G 2: 41,269,222 S1569P probably damaging Het
Lrp2 T G 2: 69,521,787 Q635P probably damaging Het
Mboat2 T C 12: 24,948,382 probably null Het
Mctp1 A G 13: 76,806,259 T596A probably benign Het
Mroh9 T A 1: 163,060,682 M275L probably benign Het
Ms4a10 A C 19: 10,967,505 probably null Het
Myo9a C T 9: 59,815,334 R560C probably damaging Het
Olfr1348 T A 7: 6,501,821 H135L probably damaging Het
Olfr1461 A G 19: 13,165,415 T134A probably benign Het
Olfr747 A G 14: 50,681,259 I125T probably damaging Het
Ormdl3 A G 11: 98,583,982 V45A possibly damaging Het
Parp4 T C 14: 56,620,592 Y894H probably benign Het
Pigo G A 4: 43,023,380 Q259* probably null Het
Prrc2a G A 17: 35,161,827 P70S unknown Het
Rab3ip A G 10: 116,937,536 I124T probably benign Het
Rap1b A G 10: 117,818,479 I21T probably benign Het
Rasgrf2 T A 13: 91,983,613 S642C probably damaging Het
Rb1 T C 14: 73,298,099 E106G probably benign Het
Reps1 C A 10: 18,107,689 R427S probably damaging Het
Rnf213 A C 11: 119,479,655 H4760P possibly damaging Het
Rtl1 A G 12: 109,593,161 I748T probably damaging Het
Sco1 A T 11: 67,053,857 K102M probably damaging Het
Sec16b T C 1: 157,534,711 M44T possibly damaging Het
Smchd1 T C 17: 71,349,667 H1935R probably benign Het
Sowaha G A 11: 53,479,223 R229W probably damaging Het
Sptlc3 A T 2: 139,537,688 M83L probably benign Het
Tbc1d9 T C 8: 83,241,563 V431A probably benign Het
Tmem98 A G 11: 80,821,388 E217G possibly damaging Het
Trim13 T A 14: 61,605,113 L193* probably null Het
Trp53bp2 T C 1: 182,442,735 S367P probably benign Het
Tsc2 T G 17: 24,626,739 I202L probably damaging Het
Twf2 T A 9: 106,214,880 V312E probably damaging Het
Usp34 G T 11: 23,361,622 L471F probably damaging Het
Vps37c A G 19: 10,706,268 D18G probably damaging Het
Other mutations in Slc7a10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01328:Slc7a10 APN 7 35186492 missense possibly damaging 0.90
IGL02728:Slc7a10 APN 7 35197698 missense probably damaging 1.00
IGL02892:Slc7a10 APN 7 35195168 missense possibly damaging 0.67
R0671:Slc7a10 UTSW 7 35197333 missense probably benign 0.00
R1943:Slc7a10 UTSW 7 35200298 missense probably benign 0.07
R3743:Slc7a10 UTSW 7 35198900 missense probably damaging 0.99
R4256:Slc7a10 UTSW 7 35198715 missense probably damaging 0.96
R4583:Slc7a10 UTSW 7 35197952 critical splice donor site probably null
R4638:Slc7a10 UTSW 7 35197930 missense probably damaging 1.00
R4749:Slc7a10 UTSW 7 35200762 missense probably damaging 1.00
R5023:Slc7a10 UTSW 7 35197355 missense possibly damaging 0.48
R5755:Slc7a10 UTSW 7 35198911 missense probably damaging 0.99
R6247:Slc7a10 UTSW 7 35186587 missense possibly damaging 0.57
R6430:Slc7a10 UTSW 7 35197658 missense probably benign
R6450:Slc7a10 UTSW 7 35186590 missense possibly damaging 0.83
R6814:Slc7a10 UTSW 7 35195264 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GGTGCTCAGACAGAGGTTTG -3'
(R):5'- CTCCAAAAGTAGAGAGGGCCAC -3'

Sequencing Primer
(F):5'- AGACGGCAGTATGTCCCTG -3'
(R):5'- CCACAGAGACGGGCATGAC -3'
Posted On2019-05-13