Incidental Mutation 'R7026:Reps1'
ID545970
Institutional Source Beutler Lab
Gene Symbol Reps1
Ensembl Gene ENSMUSG00000019854
Gene NameRalBP1 associated Eps domain containing protein
Synonyms
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.578) question?
Stock #R7026 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location18055861-18125155 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 18107689 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 427 (R427S)
Ref Sequence ENSEMBL: ENSMUSP00000123238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000126390] [ENSMUST00000154718] [ENSMUST00000155284] [ENSMUST00000164556]
PDB Structure
SOLUTION STRUCTURE OF THE REPS1 EH DOMAIN [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000126390
AA Change: R427S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000123238
Gene: ENSMUSG00000019854
AA Change: R427S

DomainStartEndE-ValueType
EH 3 99 2.34e-2 SMART
low complexity region 156 175 N/A INTRINSIC
low complexity region 205 216 N/A INTRINSIC
low complexity region 254 265 N/A INTRINSIC
EH 278 373 2.18e-34 SMART
low complexity region 390 406 N/A INTRINSIC
low complexity region 545 561 N/A INTRINSIC
low complexity region 574 599 N/A INTRINSIC
Blast:MYSc 613 671 1e-15 BLAST
coiled coil region 750 790 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150029
SMART Domains Protein: ENSMUSP00000119651
Gene: ENSMUSG00000019854

DomainStartEndE-ValueType
Blast:EH 2 86 5e-51 BLAST
low complexity region 143 162 N/A INTRINSIC
low complexity region 192 203 N/A INTRINSIC
low complexity region 241 252 N/A INTRINSIC
EH 265 360 2.18e-34 SMART
low complexity region 377 393 N/A INTRINSIC
low complexity region 505 521 N/A INTRINSIC
low complexity region 534 559 N/A INTRINSIC
Blast:MYSc 573 631 1e-15 BLAST
coiled coil region 709 749 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154718
SMART Domains Protein: ENSMUSP00000119358
Gene: ENSMUSG00000019854

DomainStartEndE-ValueType
EH 3 99 2.34e-2 SMART
low complexity region 156 175 N/A INTRINSIC
low complexity region 205 216 N/A INTRINSIC
low complexity region 254 265 N/A INTRINSIC
EH 278 373 2.18e-34 SMART
low complexity region 390 406 N/A INTRINSIC
low complexity region 484 509 N/A INTRINSIC
Blast:MYSc 523 581 9e-16 BLAST
coiled coil region 660 700 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155284
SMART Domains Protein: ENSMUSP00000119629
Gene: ENSMUSG00000019854

DomainStartEndE-ValueType
Blast:EH 3 99 6e-65 BLAST
low complexity region 156 175 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000117431
Gene: ENSMUSG00000019854
AA Change: R134S

DomainStartEndE-ValueType
EH 2 82 9.44e-21 SMART
low complexity region 99 115 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155959
SMART Domains Protein: ENSMUSP00000114387
Gene: ENSMUSG00000019854

DomainStartEndE-ValueType
low complexity region 1 17 N/A INTRINSIC
low complexity region 47 58 N/A INTRINSIC
low complexity region 75 86 N/A INTRINSIC
EH 99 194 2.18e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164556
SMART Domains Protein: ENSMUSP00000130501
Gene: ENSMUSG00000019854

DomainStartEndE-ValueType
EH 3 99 2.34e-2 SMART
low complexity region 156 175 N/A INTRINSIC
low complexity region 205 216 N/A INTRINSIC
low complexity region 254 265 N/A INTRINSIC
EH 278 373 2.18e-34 SMART
low complexity region 390 406 N/A INTRINSIC
low complexity region 518 534 N/A INTRINSIC
low complexity region 547 572 N/A INTRINSIC
Blast:MYSc 586 644 9e-16 BLAST
coiled coil region 723 763 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000216576
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a signaling adaptor protein with two EH domains that interacts with proteins that participate in signaling, endocytosis and cytoskeletal changes. The encoded protein has been found in association with intersectin 1 and Src homology 3-domain growth factor receptor-bound 2-like (endophilin) interacting protein 1 when intersectin 1 was isolated from clathrin-coated pits. The encoded protein has also been shown to interact with amphiphysin, a cytoplasmic protein at the surface of synaptic vesicles. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 A T 19: 43,816,953 M749L probably benign Het
Abcc2 A G 19: 43,830,535 N1321S probably benign Het
Acsm2 T A 7: 119,592,227 V506E probably damaging Het
Add2 G A 6: 86,086,983 R88Q probably benign Het
Adgra3 A G 5: 49,960,741 V1155A probably benign Het
Ahsg T A 16: 22,892,213 D33E probably damaging Het
Alox12b A T 11: 69,157,305 D20V possibly damaging Het
Alppl2 A G 1: 87,089,698 probably null Het
Ankfn1 A G 11: 89,639,577 *49Q probably null Het
Bcl11b T C 12: 107,916,592 D488G probably damaging Het
Bcl2l10 T A 9: 75,351,082 F175L probably benign Het
C2cd3 T A 7: 100,432,092 D127E probably damaging Het
Cacna1c C T 6: 118,637,771 V1311I probably damaging Het
Cd55b A T 1: 130,388,690 I374K probably benign Het
Cfap36 T C 11: 29,222,565 T267A probably benign Het
Cog1 T C 11: 113,649,589 L10P probably damaging Het
Dnah7a T A 1: 53,504,289 M2241L probably benign Het
Dock10 G T 1: 80,501,787 A1809E probably benign Het
Dock7 A T 4: 99,078,919 D255E probably benign Het
Exph5 T C 9: 53,340,428 F123L probably benign Het
Fam92b G A 8: 120,168,585 H193Y probably damaging Het
Fbxw27 C A 9: 109,788,078 K118N possibly damaging Het
Fscb C A 12: 64,471,617 S1025I unknown Het
Get4 C T 5: 139,252,603 R47W possibly damaging Het
Gm14409 T A 2: 177,265,568 I46F probably benign Het
Gm3676 G A 14: 41,644,115 S81F probably benign Het
Gulp1 C T 1: 44,781,085 P251S possibly damaging Het
Hhatl T C 9: 121,788,273 D298G probably benign Het
Hsf2bp T A 17: 32,033,280 K60N possibly damaging Het
Ints4 T A 7: 97,519,154 V625D possibly damaging Het
Iqch T A 9: 63,525,139 K286* probably null Het
Irak1bp1 T A 9: 82,830,031 S2T possibly damaging Het
Kdm3b G A 18: 34,822,464 V1135I possibly damaging Het
Lama3 C A 18: 12,516,548 N181K probably damaging Het
Lrfn2 T G 17: 49,096,977 S709R probably benign Het
Lrp12 T C 15: 39,880,170 H123R probably damaging Het
Lrp1b A G 2: 41,269,222 S1569P probably damaging Het
Lrp2 T G 2: 69,521,787 Q635P probably damaging Het
Mboat2 T C 12: 24,948,382 probably null Het
Mctp1 A G 13: 76,806,259 T596A probably benign Het
Mroh9 T A 1: 163,060,682 M275L probably benign Het
Ms4a10 A C 19: 10,967,505 probably null Het
Myo9a C T 9: 59,815,334 R560C probably damaging Het
Olfr1348 T A 7: 6,501,821 H135L probably damaging Het
Olfr1461 A G 19: 13,165,415 T134A probably benign Het
Olfr747 A G 14: 50,681,259 I125T probably damaging Het
Ormdl3 A G 11: 98,583,982 V45A possibly damaging Het
Parp4 T C 14: 56,620,592 Y894H probably benign Het
Pigo G A 4: 43,023,380 Q259* probably null Het
Prrc2a G A 17: 35,161,827 P70S unknown Het
Rab3ip A G 10: 116,937,536 I124T probably benign Het
Rap1b A G 10: 117,818,479 I21T probably benign Het
Rasgrf2 T A 13: 91,983,613 S642C probably damaging Het
Rb1 T C 14: 73,298,099 E106G probably benign Het
Rnf213 A C 11: 119,479,655 H4760P possibly damaging Het
Rtl1 A G 12: 109,593,161 I748T probably damaging Het
Sco1 A T 11: 67,053,857 K102M probably damaging Het
Sec16b T C 1: 157,534,711 M44T possibly damaging Het
Slc7a10 T C 7: 35,198,714 M297T probably damaging Het
Smchd1 T C 17: 71,349,667 H1935R probably benign Het
Sowaha G A 11: 53,479,223 R229W probably damaging Het
Sptlc3 A T 2: 139,537,688 M83L probably benign Het
Tbc1d9 T C 8: 83,241,563 V431A probably benign Het
Tmem98 A G 11: 80,821,388 E217G possibly damaging Het
Trim13 T A 14: 61,605,113 L193* probably null Het
Trp53bp2 T C 1: 182,442,735 S367P probably benign Het
Tsc2 T G 17: 24,626,739 I202L probably damaging Het
Twf2 T A 9: 106,214,880 V312E probably damaging Het
Usp34 G T 11: 23,361,622 L471F probably damaging Het
Vps37c A G 19: 10,706,268 D18G probably damaging Het
Other mutations in Reps1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01019:Reps1 APN 10 18124895 missense probably damaging 1.00
IGL01161:Reps1 APN 10 18093895 missense probably damaging 1.00
IGL01606:Reps1 APN 10 18107687 missense probably damaging 1.00
IGL01937:Reps1 APN 10 18093836 missense probably benign 0.04
IGL01945:Reps1 APN 10 18093836 missense probably benign 0.04
IGL02208:Reps1 APN 10 18119022 missense probably damaging 1.00
IGL02335:Reps1 APN 10 18056117 critical splice donor site probably null
IGL02706:Reps1 APN 10 18123015 splice site probably benign
IGL02747:Reps1 APN 10 18123600 missense probably damaging 1.00
R0554:Reps1 UTSW 10 18123119 missense possibly damaging 0.71
R0628:Reps1 UTSW 10 18121093 missense probably damaging 1.00
R1074:Reps1 UTSW 10 18094446 missense probably benign 0.01
R1710:Reps1 UTSW 10 18118950 missense possibly damaging 0.75
R1829:Reps1 UTSW 10 18107714 missense probably damaging 1.00
R2116:Reps1 UTSW 10 18124920 missense probably damaging 1.00
R2146:Reps1 UTSW 10 18093313 missense probably benign
R2161:Reps1 UTSW 10 18096283 missense probably damaging 0.99
R3704:Reps1 UTSW 10 18107680 missense probably damaging 1.00
R4115:Reps1 UTSW 10 18104207 missense possibly damaging 0.93
R4654:Reps1 UTSW 10 18114400 missense probably damaging 1.00
R4856:Reps1 UTSW 10 18123625 missense probably damaging 1.00
R4910:Reps1 UTSW 10 18107688 missense probably damaging 1.00
R5127:Reps1 UTSW 10 18093880 missense probably benign
R5521:Reps1 UTSW 10 18104234 missense probably damaging 1.00
R5707:Reps1 UTSW 10 18056010 missense probably benign 0.06
R5724:Reps1 UTSW 10 18114483 missense possibly damaging 0.75
R6564:Reps1 UTSW 10 18122392 intron probably null
R6996:Reps1 UTSW 10 18093855 missense probably damaging 1.00
X0062:Reps1 UTSW 10 18104226 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACATTTGCTTATGAAGGTGTTTGCC -3'
(R):5'- CCAAAGGCCTGCCAACTTTC -3'

Sequencing Primer
(F):5'- CTGTTTATAAGATGGCCCAGCACAG -3'
(R):5'- TTCCCTCTAAGCACTACACTGAATC -3'
Posted On2019-05-13