Incidental Mutation 'R7026:Usp34'
ID545973
Institutional Source Beutler Lab
Gene Symbol Usp34
Ensembl Gene ENSMUSG00000056342
Gene Nameubiquitin specific peptidase 34
SynonymsMurr2, A530081C03Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.373) question?
Stock #R7026 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location23306895-23490560 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 23361622 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 471 (L471F)
Ref Sequence ENSEMBL: ENSMUSP00000137430 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000180046]
Predicted Effect
SMART Domains Protein: ENSMUSP00000120747
Gene: ENSMUSG00000056342
AA Change: L490F

DomainStartEndE-ValueType
low complexity region 489 500 N/A INTRINSIC
low complexity region 530 544 N/A INTRINSIC
low complexity region 591 610 N/A INTRINSIC
coiled coil region 626 671 N/A INTRINSIC
low complexity region 827 842 N/A INTRINSIC
low complexity region 1207 1218 N/A INTRINSIC
low complexity region 1399 1410 N/A INTRINSIC
low complexity region 1518 1532 N/A INTRINSIC
low complexity region 1751 1764 N/A INTRINSIC
low complexity region 1812 1824 N/A INTRINSIC
Pfam:UCH 1950 2293 7.6e-44 PFAM
Pfam:UCH_1 1951 2249 3.6e-22 PFAM
low complexity region 2542 2564 N/A INTRINSIC
low complexity region 2672 2679 N/A INTRINSIC
Blast:Drf_GBD 2943 3116 3e-53 BLAST
low complexity region 3344 3357 N/A INTRINSIC
coiled coil region 3371 3393 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000180046
AA Change: L471F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000137430
Gene: ENSMUSG00000056342
AA Change: L471F

DomainStartEndE-ValueType
low complexity region 469 480 N/A INTRINSIC
low complexity region 510 524 N/A INTRINSIC
low complexity region 571 590 N/A INTRINSIC
coiled coil region 607 652 N/A INTRINSIC
low complexity region 807 822 N/A INTRINSIC
low complexity region 1187 1198 N/A INTRINSIC
low complexity region 1379 1390 N/A INTRINSIC
low complexity region 1498 1512 N/A INTRINSIC
low complexity region 1731 1744 N/A INTRINSIC
low complexity region 1792 1804 N/A INTRINSIC
Pfam:UCH 1930 2273 2.3e-44 PFAM
Pfam:UCH_1 1931 2229 1.1e-22 PFAM
low complexity region 2522 2544 N/A INTRINSIC
low complexity region 2652 2659 N/A INTRINSIC
Blast:Drf_GBD 2923 3096 2e-53 BLAST
low complexity region 3324 3337 N/A INTRINSIC
coiled coil region 3352 3374 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 99% (69/70)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 A T 19: 43,816,953 M749L probably benign Het
Abcc2 A G 19: 43,830,535 N1321S probably benign Het
Acsm2 T A 7: 119,592,227 V506E probably damaging Het
Add2 G A 6: 86,086,983 R88Q probably benign Het
Adgra3 A G 5: 49,960,741 V1155A probably benign Het
Ahsg T A 16: 22,892,213 D33E probably damaging Het
Alox12b A T 11: 69,157,305 D20V possibly damaging Het
Alppl2 A G 1: 87,089,698 probably null Het
Ankfn1 A G 11: 89,639,577 *49Q probably null Het
Bcl11b T C 12: 107,916,592 D488G probably damaging Het
Bcl2l10 T A 9: 75,351,082 F175L probably benign Het
C2cd3 T A 7: 100,432,092 D127E probably damaging Het
Cacna1c C T 6: 118,637,771 V1311I probably damaging Het
Cd55b A T 1: 130,388,690 I374K probably benign Het
Cfap36 T C 11: 29,222,565 T267A probably benign Het
Cog1 T C 11: 113,649,589 L10P probably damaging Het
Dnah7a T A 1: 53,504,289 M2241L probably benign Het
Dock10 G T 1: 80,501,787 A1809E probably benign Het
Dock7 A T 4: 99,078,919 D255E probably benign Het
Exph5 T C 9: 53,340,428 F123L probably benign Het
Fam92b G A 8: 120,168,585 H193Y probably damaging Het
Fbxw27 C A 9: 109,788,078 K118N possibly damaging Het
Fscb C A 12: 64,471,617 S1025I unknown Het
Get4 C T 5: 139,252,603 R47W possibly damaging Het
Gm14409 T A 2: 177,265,568 I46F probably benign Het
Gm3676 G A 14: 41,644,115 S81F probably benign Het
Gulp1 C T 1: 44,781,085 P251S possibly damaging Het
Hhatl T C 9: 121,788,273 D298G probably benign Het
Hsf2bp T A 17: 32,033,280 K60N possibly damaging Het
Ints4 T A 7: 97,519,154 V625D possibly damaging Het
Iqch T A 9: 63,525,139 K286* probably null Het
Irak1bp1 T A 9: 82,830,031 S2T possibly damaging Het
Kdm3b G A 18: 34,822,464 V1135I possibly damaging Het
Lama3 C A 18: 12,516,548 N181K probably damaging Het
Lrfn2 T G 17: 49,096,977 S709R probably benign Het
Lrp12 T C 15: 39,880,170 H123R probably damaging Het
Lrp1b A G 2: 41,269,222 S1569P probably damaging Het
Lrp2 T G 2: 69,521,787 Q635P probably damaging Het
Mboat2 T C 12: 24,948,382 probably null Het
Mctp1 A G 13: 76,806,259 T596A probably benign Het
Mroh9 T A 1: 163,060,682 M275L probably benign Het
Ms4a10 A C 19: 10,967,505 probably null Het
Myo9a C T 9: 59,815,334 R560C probably damaging Het
Olfr1348 T A 7: 6,501,821 H135L probably damaging Het
Olfr1461 A G 19: 13,165,415 T134A probably benign Het
Olfr747 A G 14: 50,681,259 I125T probably damaging Het
Ormdl3 A G 11: 98,583,982 V45A possibly damaging Het
Parp4 T C 14: 56,620,592 Y894H probably benign Het
Pigo G A 4: 43,023,380 Q259* probably null Het
Prrc2a G A 17: 35,161,827 P70S unknown Het
Rab3ip A G 10: 116,937,536 I124T probably benign Het
Rap1b A G 10: 117,818,479 I21T probably benign Het
Rasgrf2 T A 13: 91,983,613 S642C probably damaging Het
Rb1 T C 14: 73,298,099 E106G probably benign Het
Reps1 C A 10: 18,107,689 R427S probably damaging Het
Rnf213 A C 11: 119,479,655 H4760P possibly damaging Het
Rtl1 A G 12: 109,593,161 I748T probably damaging Het
Sco1 A T 11: 67,053,857 K102M probably damaging Het
Sec16b T C 1: 157,534,711 M44T possibly damaging Het
Slc7a10 T C 7: 35,198,714 M297T probably damaging Het
Smchd1 T C 17: 71,349,667 H1935R probably benign Het
Sowaha G A 11: 53,479,223 R229W probably damaging Het
Sptlc3 A T 2: 139,537,688 M83L probably benign Het
Tbc1d9 T C 8: 83,241,563 V431A probably benign Het
Tmem98 A G 11: 80,821,388 E217G possibly damaging Het
Trim13 T A 14: 61,605,113 L193* probably null Het
Trp53bp2 T C 1: 182,442,735 S367P probably benign Het
Tsc2 T G 17: 24,626,739 I202L probably damaging Het
Twf2 T A 9: 106,214,880 V312E probably damaging Het
Vps37c A G 19: 10,706,268 D18G probably damaging Het
Other mutations in Usp34
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Usp34 APN 11 23436020 missense probably damaging 0.98
IGL00477:Usp34 APN 11 23468879 missense probably damaging 0.99
IGL01307:Usp34 APN 11 23417676 missense probably damaging 0.99
IGL01313:Usp34 APN 11 23473206 missense probably damaging 1.00
IGL01794:Usp34 APN 11 23436020 missense probably damaging 0.98
IGL01826:Usp34 APN 11 23436020 missense probably damaging 0.98
IGL01827:Usp34 APN 11 23436020 missense probably damaging 0.98
IGL01830:Usp34 APN 11 23436020 missense probably damaging 0.98
IGL01867:Usp34 APN 11 23384411 missense possibly damaging 0.77
IGL01939:Usp34 APN 11 23345141 splice site probably benign
IGL01977:Usp34 APN 11 23452661 missense probably damaging 1.00
IGL01985:Usp34 APN 11 23452565 missense probably damaging 1.00
IGL02011:Usp34 APN 11 23471554 missense probably damaging 0.99
IGL02302:Usp34 APN 11 23467243 missense possibly damaging 0.91
IGL02423:Usp34 APN 11 23354900 missense probably benign 0.11
IGL02491:Usp34 APN 11 23432630 missense probably damaging 0.98
IGL02532:Usp34 APN 11 23370291 missense probably damaging 0.99
IGL02561:Usp34 APN 11 23351652 missense probably benign 0.09
IGL02706:Usp34 APN 11 23388659 splice site probably benign
IGL02891:Usp34 APN 11 23487166 missense probably benign 0.09
IGL03079:Usp34 APN 11 23432247 missense possibly damaging 0.48
IGL03089:Usp34 APN 11 23446958 missense possibly damaging 0.84
IGL03175:Usp34 APN 11 23488686 missense probably benign
IGL03256:Usp34 APN 11 23420090 nonsense probably null
IGL03280:Usp34 APN 11 23354897 missense probably damaging 1.00
IGL03289:Usp34 APN 11 23393818 missense possibly damaging 0.94
IGL03408:Usp34 APN 11 23446957 missense possibly damaging 0.92
chub UTSW 11 23464686 missense probably damaging 0.99
Cicione UTSW 11 23489033 missense possibly damaging 0.85
I2288:Usp34 UTSW 11 23432473 splice site probably benign
R0047:Usp34 UTSW 11 23464403 missense probably benign 0.34
R0047:Usp34 UTSW 11 23464403 missense probably benign 0.34
R0099:Usp34 UTSW 11 23363111 missense probably damaging 1.00
R0240:Usp34 UTSW 11 23433206 missense probably damaging 0.99
R0240:Usp34 UTSW 11 23433206 missense probably damaging 0.99
R0403:Usp34 UTSW 11 23333838 missense possibly damaging 0.82
R0432:Usp34 UTSW 11 23401505 missense probably damaging 0.99
R0446:Usp34 UTSW 11 23467207 missense probably damaging 0.97
R0455:Usp34 UTSW 11 23446741 splice site probably benign
R0470:Usp34 UTSW 11 23436001 missense possibly damaging 0.94
R0472:Usp34 UTSW 11 23384509 splice site probably benign
R0512:Usp34 UTSW 11 23451997 missense probably benign 0.04
R0557:Usp34 UTSW 11 23403848 missense probably damaging 0.98
R0562:Usp34 UTSW 11 23432406 splice site probably benign
R0656:Usp34 UTSW 11 23472967 missense probably damaging 0.99
R0693:Usp34 UTSW 11 23452637 missense probably damaging 0.97
R0739:Usp34 UTSW 11 23467243 missense possibly damaging 0.91
R1061:Usp34 UTSW 11 23384420 missense possibly damaging 0.51
R1078:Usp34 UTSW 11 23433175 splice site probably benign
R1223:Usp34 UTSW 11 23446464 synonymous probably null
R1295:Usp34 UTSW 11 23384477 missense probably damaging 1.00
R1430:Usp34 UTSW 11 23459151 missense probably damaging 0.97
R1445:Usp34 UTSW 11 23351629 missense probably damaging 0.99
R1468:Usp34 UTSW 11 23441171 missense probably damaging 1.00
R1468:Usp34 UTSW 11 23441171 missense probably damaging 1.00
R1471:Usp34 UTSW 11 23488862 missense probably benign 0.20
R1475:Usp34 UTSW 11 23473253 missense probably damaging 0.99
R1628:Usp34 UTSW 11 23488725 missense probably damaging 1.00
R1631:Usp34 UTSW 11 23460651 missense probably damaging 0.99
R1655:Usp34 UTSW 11 23375051 missense probably benign 0.05
R1741:Usp34 UTSW 11 23364103 missense probably benign 0.00
R1854:Usp34 UTSW 11 23426153 missense probably benign 0.24
R1867:Usp34 UTSW 11 23361593 missense possibly damaging 0.82
R1869:Usp34 UTSW 11 23364479 missense probably benign 0.37
R1870:Usp34 UTSW 11 23364479 missense probably benign 0.37
R1871:Usp34 UTSW 11 23364479 missense probably benign 0.37
R1967:Usp34 UTSW 11 23364503 missense probably benign 0.01
R2051:Usp34 UTSW 11 23464468 missense probably damaging 0.97
R2132:Usp34 UTSW 11 23464556 missense possibly damaging 0.95
R2156:Usp34 UTSW 11 23382602 missense probably damaging 0.98
R2205:Usp34 UTSW 11 23385147 missense probably damaging 0.97
R2342:Usp34 UTSW 11 23403599 missense possibly damaging 0.46
R3431:Usp34 UTSW 11 23370466 missense possibly damaging 0.95
R3812:Usp34 UTSW 11 23464517 missense possibly damaging 0.94
R3872:Usp34 UTSW 11 23489033 missense possibly damaging 0.85
R3873:Usp34 UTSW 11 23489033 missense possibly damaging 0.85
R3874:Usp34 UTSW 11 23489033 missense possibly damaging 0.85
R3875:Usp34 UTSW 11 23489033 missense possibly damaging 0.85
R3925:Usp34 UTSW 11 23343640 missense probably benign 0.28
R3972:Usp34 UTSW 11 23457803 missense probably damaging 1.00
R4018:Usp34 UTSW 11 23489033 missense possibly damaging 0.85
R4042:Usp34 UTSW 11 23489033 missense possibly damaging 0.85
R4155:Usp34 UTSW 11 23417676 missense probably damaging 0.99
R4197:Usp34 UTSW 11 23444189 missense probably damaging 0.98
R4352:Usp34 UTSW 11 23320727 missense possibly damaging 0.73
R4379:Usp34 UTSW 11 23384499 missense possibly damaging 0.52
R4444:Usp34 UTSW 11 23435998 missense probably damaging 0.98
R4475:Usp34 UTSW 11 23457975 missense possibly damaging 0.95
R4501:Usp34 UTSW 11 23401529 missense probably damaging 1.00
R4527:Usp34 UTSW 11 23421257 missense possibly damaging 0.57
R4603:Usp34 UTSW 11 23464633 missense probably damaging 0.97
R4612:Usp34 UTSW 11 23432268 missense probably damaging 0.99
R4673:Usp34 UTSW 11 23364480 small deletion probably benign
R4707:Usp34 UTSW 11 23487215 missense probably damaging 1.00
R4736:Usp34 UTSW 11 23393749 splice site probably null
R4867:Usp34 UTSW 11 23451999 missense probably benign 0.28
R4879:Usp34 UTSW 11 23373410 missense possibly damaging 0.94
R4977:Usp34 UTSW 11 23488982 missense probably damaging 1.00
R5004:Usp34 UTSW 11 23464586 missense probably damaging 1.00
R5057:Usp34 UTSW 11 23458086 intron probably benign
R5068:Usp34 UTSW 11 23460665 missense possibly damaging 0.94
R5304:Usp34 UTSW 11 23343616 missense probably damaging 1.00
R5320:Usp34 UTSW 11 23333739 missense probably benign
R5327:Usp34 UTSW 11 23468846 missense probably damaging 1.00
R5328:Usp34 UTSW 11 23464616 missense probably benign 0.01
R5328:Usp34 UTSW 11 23488659 missense probably benign 0.04
R5390:Usp34 UTSW 11 23444202 critical splice donor site probably null
R5434:Usp34 UTSW 11 23412271 missense probably damaging 0.99
R5523:Usp34 UTSW 11 23349198 missense probably benign 0.39
R5567:Usp34 UTSW 11 23488336 missense probably damaging 0.97
R5571:Usp34 UTSW 11 23457975 missense probably damaging 0.99
R5645:Usp34 UTSW 11 23375024 missense possibly damaging 0.86
R5713:Usp34 UTSW 11 23343515 missense possibly damaging 0.94
R5719:Usp34 UTSW 11 23354846 missense probably benign 0.00
R5813:Usp34 UTSW 11 23421340 missense probably benign 0.38
R5921:Usp34 UTSW 11 23464686 missense probably damaging 0.99
R5928:Usp34 UTSW 11 23436040 missense probably damaging 0.98
R5944:Usp34 UTSW 11 23363089 missense probably damaging 1.00
R6198:Usp34 UTSW 11 23484127 missense probably damaging 1.00
R6229:Usp34 UTSW 11 23446778 missense probably damaging 0.99
R6306:Usp34 UTSW 11 23412260 missense possibly damaging 0.94
R6320:Usp34 UTSW 11 23452520 missense probably damaging 0.98
R6341:Usp34 UTSW 11 23381353 missense probably damaging 0.97
R6374:Usp34 UTSW 11 23438914 missense probably damaging 1.00
R6398:Usp34 UTSW 11 23488666 missense probably benign
R6438:Usp34 UTSW 11 23364266 missense probably benign 0.02
R6668:Usp34 UTSW 11 23460659 missense probably damaging 0.97
R6700:Usp34 UTSW 11 23439011 missense probably damaging 1.00
R6783:Usp34 UTSW 11 23412318 missense probably damaging 1.00
R6821:Usp34 UTSW 11 23367491 missense possibly damaging 0.79
R6855:Usp34 UTSW 11 23452569 missense possibly damaging 0.94
R6916:Usp34 UTSW 11 23458023 missense probably damaging 0.98
R7020:Usp34 UTSW 11 23393954 missense probably benign 0.05
R7085:Usp34 UTSW 11 23363097 missense
R7101:Usp34 UTSW 11 23426183 missense
R7168:Usp34 UTSW 11 23464585 missense
R7192:Usp34 UTSW 11 23460571 missense
R7264:Usp34 UTSW 11 23333566 missense probably benign 0.00
X0023:Usp34 UTSW 11 23375028 missense possibly damaging 0.73
X0057:Usp34 UTSW 11 23457824 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- GCACAATGAGGATTTTGCTTAGTTG -3'
(R):5'- AGTCTTTATTCAACAGAGTTGTGGG -3'

Sequencing Primer
(F):5'- TGCCCCAGAGCTTCTAA -3'
(R):5'- CAACAGAGTTGTGGGGTTTAATTTAC -3'
Posted On2019-05-13