Incidental Mutation 'R7026:Sco1'
ID545976
Institutional Source Beutler Lab
Gene Symbol Sco1
Ensembl Gene ENSMUSG00000069844
Gene NameSCO1 cytochrome c oxidase assembly protein
SynonymsD11Bwg1310e, 2610001C07Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.848) question?
Stock #R7026 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location67052670-67067070 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 67053857 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Methionine at position 102 (K102M)
Ref Sequence ENSEMBL: ENSMUSP00000104330 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092996] [ENSMUST00000108690] [ENSMUST00000116363] [ENSMUST00000146338]
Predicted Effect probably damaging
Transcript: ENSMUST00000092996
AA Change: K102M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000090673
Gene: ENSMUSG00000069844
AA Change: K102M

DomainStartEndE-ValueType
low complexity region 50 67 N/A INTRINSIC
Pfam:SCO1-SenC 81 265 1.5e-48 PFAM
Pfam:AhpC-TSA 118 250 9.8e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108690
AA Change: K102M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104330
Gene: ENSMUSG00000069844
AA Change: K102M

DomainStartEndE-ValueType
low complexity region 50 67 N/A INTRINSIC
Pfam:SCO1-SenC 91 270 2.4e-49 PFAM
Pfam:AhpC-TSA 125 254 7.6e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000116363
SMART Domains Protein: ENSMUSP00000112064
Gene: ENSMUSG00000020910

DomainStartEndE-ValueType
Pfam:Metallophos 18 282 1.8e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146338
SMART Domains Protein: ENSMUSP00000137768
Gene: ENSMUSG00000020910

DomainStartEndE-ValueType
PDB:2NXF|A 13 199 4e-47 PDB
SCOP:d1utea_ 15 176 3e-11 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian cytochrome c oxidase (COX) catalyzes the transfer of reducing equivalents from cytochrome c to molecular oxygen and pumps protons across the inner mitochondrial membrane. In yeast, 2 related COX assembly genes, SCO1 and SCO2 (synthesis of cytochrome c oxidase), enable subunits 1 and 2 to be incorporated into the holoprotein. This gene is the human homolog to the yeast SCO1 gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a conditional allele knocked out in the liver exhibit weight loss, premature death, spleen atrophy, reduced white blood cells, increased mitochondria proliferation, increased iron levels in the liver and spleen, and decreased copper levels in the liver and kidney. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 A T 19: 43,816,953 M749L probably benign Het
Abcc2 A G 19: 43,830,535 N1321S probably benign Het
Acsm2 T A 7: 119,592,227 V506E probably damaging Het
Add2 G A 6: 86,086,983 R88Q probably benign Het
Adgra3 A G 5: 49,960,741 V1155A probably benign Het
Ahsg T A 16: 22,892,213 D33E probably damaging Het
Alox12b A T 11: 69,157,305 D20V possibly damaging Het
Alppl2 A G 1: 87,089,698 probably null Het
Ankfn1 A G 11: 89,639,577 *49Q probably null Het
Bcl11b T C 12: 107,916,592 D488G probably damaging Het
Bcl2l10 T A 9: 75,351,082 F175L probably benign Het
C2cd3 T A 7: 100,432,092 D127E probably damaging Het
Cacna1c C T 6: 118,637,771 V1311I probably damaging Het
Cd55b A T 1: 130,388,690 I374K probably benign Het
Cfap36 T C 11: 29,222,565 T267A probably benign Het
Cog1 T C 11: 113,649,589 L10P probably damaging Het
Dnah7a T A 1: 53,504,289 M2241L probably benign Het
Dock10 G T 1: 80,501,787 A1809E probably benign Het
Dock7 A T 4: 99,078,919 D255E probably benign Het
Exph5 T C 9: 53,340,428 F123L probably benign Het
Fam92b G A 8: 120,168,585 H193Y probably damaging Het
Fbxw27 C A 9: 109,788,078 K118N possibly damaging Het
Fscb C A 12: 64,471,617 S1025I unknown Het
Get4 C T 5: 139,252,603 R47W possibly damaging Het
Gm14409 T A 2: 177,265,568 I46F probably benign Het
Gm3676 G A 14: 41,644,115 S81F probably benign Het
Gulp1 C T 1: 44,781,085 P251S possibly damaging Het
Hhatl T C 9: 121,788,273 D298G probably benign Het
Hsf2bp T A 17: 32,033,280 K60N possibly damaging Het
Ints4 T A 7: 97,519,154 V625D possibly damaging Het
Iqch T A 9: 63,525,139 K286* probably null Het
Irak1bp1 T A 9: 82,830,031 S2T possibly damaging Het
Kdm3b G A 18: 34,822,464 V1135I possibly damaging Het
Lama3 C A 18: 12,516,548 N181K probably damaging Het
Lrfn2 T G 17: 49,096,977 S709R probably benign Het
Lrp12 T C 15: 39,880,170 H123R probably damaging Het
Lrp1b A G 2: 41,269,222 S1569P probably damaging Het
Lrp2 T G 2: 69,521,787 Q635P probably damaging Het
Mboat2 T C 12: 24,948,382 probably null Het
Mctp1 A G 13: 76,806,259 T596A probably benign Het
Mroh9 T A 1: 163,060,682 M275L probably benign Het
Ms4a10 A C 19: 10,967,505 probably null Het
Myo9a C T 9: 59,815,334 R560C probably damaging Het
Olfr1348 T A 7: 6,501,821 H135L probably damaging Het
Olfr1461 A G 19: 13,165,415 T134A probably benign Het
Olfr747 A G 14: 50,681,259 I125T probably damaging Het
Ormdl3 A G 11: 98,583,982 V45A possibly damaging Het
Parp4 T C 14: 56,620,592 Y894H probably benign Het
Pigo G A 4: 43,023,380 Q259* probably null Het
Prrc2a G A 17: 35,161,827 P70S unknown Het
Rab3ip A G 10: 116,937,536 I124T probably benign Het
Rap1b A G 10: 117,818,479 I21T probably benign Het
Rasgrf2 T A 13: 91,983,613 S642C probably damaging Het
Rb1 T C 14: 73,298,099 E106G probably benign Het
Reps1 C A 10: 18,107,689 R427S probably damaging Het
Rnf213 A C 11: 119,479,655 H4760P possibly damaging Het
Rtl1 A G 12: 109,593,161 I748T probably damaging Het
Sec16b T C 1: 157,534,711 M44T possibly damaging Het
Slc7a10 T C 7: 35,198,714 M297T probably damaging Het
Smchd1 T C 17: 71,349,667 H1935R probably benign Het
Sowaha G A 11: 53,479,223 R229W probably damaging Het
Sptlc3 A T 2: 139,537,688 M83L probably benign Het
Tbc1d9 T C 8: 83,241,563 V431A probably benign Het
Tmem98 A G 11: 80,821,388 E217G possibly damaging Het
Trim13 T A 14: 61,605,113 L193* probably null Het
Trp53bp2 T C 1: 182,442,735 S367P probably benign Het
Tsc2 T G 17: 24,626,739 I202L probably damaging Het
Twf2 T A 9: 106,214,880 V312E probably damaging Het
Usp34 G T 11: 23,361,622 L471F probably damaging Het
Vps37c A G 19: 10,706,268 D18G probably damaging Het
Other mutations in Sco1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00960:Sco1 APN 11 67064038 makesense probably null
IGL01765:Sco1 APN 11 67053790 missense probably damaging 1.00
IGL03103:Sco1 APN 11 67055742 nonsense probably null
R2929:Sco1 UTSW 11 67063922 missense probably damaging 1.00
R3831:Sco1 UTSW 11 67053779 missense probably damaging 0.99
R3832:Sco1 UTSW 11 67053779 missense probably damaging 0.99
R3833:Sco1 UTSW 11 67053779 missense probably damaging 0.99
R4019:Sco1 UTSW 11 67064020 missense probably benign
R4020:Sco1 UTSW 11 67064020 missense probably benign
R4299:Sco1 UTSW 11 67055800 missense possibly damaging 0.84
R4541:Sco1 UTSW 11 67052842 missense probably benign 0.00
R4715:Sco1 UTSW 11 67056599 missense probably damaging 1.00
R5411:Sco1 UTSW 11 67063958 missense probably damaging 1.00
R6344:Sco1 UTSW 11 67055745 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATTCAGTGTATGCAACTGG -3'
(R):5'- CTGACCTGGAAAACAGTATCTAGGG -3'

Sequencing Primer
(F):5'- CATTCAGTGTATGCAACTGGTTTGTG -3'
(R):5'- CCCAAATAGTTCTCTGGC -3'
Posted On2019-05-13