Incidental Mutation 'R7026:Alox12b'
ID545977
Institutional Source Beutler Lab
Gene Symbol Alox12b
Ensembl Gene ENSMUSG00000032807
Gene Namearachidonate 12-lipoxygenase, 12R type
Synonymse-LOX2, 12R-LOX, Aloxe2
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7026 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location69156989-69169792 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 69157305 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 20 (D20V)
Ref Sequence ENSEMBL: ENSMUSP00000035250 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036424]
Predicted Effect possibly damaging
Transcript: ENSMUST00000036424
AA Change: D20V

PolyPhen 2 Score 0.657 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000035250
Gene: ENSMUSG00000032807
AA Change: D20V

DomainStartEndE-ValueType
LH2 2 116 9.9e-32 SMART
low complexity region 164 175 N/A INTRINSIC
Pfam:Lipoxygenase 228 686 5.3e-59 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: This gene encodes an enzyme involved in the conversion of arachidonic acid to 12R-hydroxyeicosatetraenoic acid. Mutations in this gene can prevent the formation of the epidermal permeability barrier and cause an ichthyosiform phenotype. [provided by RefSeq, Sep 2015]
PHENOTYPE: Neonatal homozygous mutant mice exhibit reddened skin that quickly dehydrates and appears scaly. The epidermis is hyperkeratotic, and its permeability barrier function is compromised. Homozygotes die within 24 hours of birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 A T 19: 43,816,953 M749L probably benign Het
Abcc2 A G 19: 43,830,535 N1321S probably benign Het
Acsm2 T A 7: 119,592,227 V506E probably damaging Het
Add2 G A 6: 86,086,983 R88Q probably benign Het
Adgra3 A G 5: 49,960,741 V1155A probably benign Het
Ahsg T A 16: 22,892,213 D33E probably damaging Het
Alppl2 A G 1: 87,089,698 probably null Het
Ankfn1 A G 11: 89,639,577 *49Q probably null Het
Bcl11b T C 12: 107,916,592 D488G probably damaging Het
Bcl2l10 T A 9: 75,351,082 F175L probably benign Het
C2cd3 T A 7: 100,432,092 D127E probably damaging Het
Cacna1c C T 6: 118,637,771 V1311I probably damaging Het
Cd55b A T 1: 130,388,690 I374K probably benign Het
Cfap36 T C 11: 29,222,565 T267A probably benign Het
Cog1 T C 11: 113,649,589 L10P probably damaging Het
Dnah7a T A 1: 53,504,289 M2241L probably benign Het
Dock10 G T 1: 80,501,787 A1809E probably benign Het
Dock7 A T 4: 99,078,919 D255E probably benign Het
Exph5 T C 9: 53,340,428 F123L probably benign Het
Fam92b G A 8: 120,168,585 H193Y probably damaging Het
Fbxw27 C A 9: 109,788,078 K118N possibly damaging Het
Fscb C A 12: 64,471,617 S1025I unknown Het
Get4 C T 5: 139,252,603 R47W possibly damaging Het
Gm14409 T A 2: 177,265,568 I46F probably benign Het
Gm3676 G A 14: 41,644,115 S81F probably benign Het
Gulp1 C T 1: 44,781,085 P251S possibly damaging Het
Hhatl T C 9: 121,788,273 D298G probably benign Het
Hsf2bp T A 17: 32,033,280 K60N possibly damaging Het
Ints4 T A 7: 97,519,154 V625D possibly damaging Het
Iqch T A 9: 63,525,139 K286* probably null Het
Irak1bp1 T A 9: 82,830,031 S2T possibly damaging Het
Kdm3b G A 18: 34,822,464 V1135I possibly damaging Het
Lama3 C A 18: 12,516,548 N181K probably damaging Het
Lrfn2 T G 17: 49,096,977 S709R probably benign Het
Lrp12 T C 15: 39,880,170 H123R probably damaging Het
Lrp1b A G 2: 41,269,222 S1569P probably damaging Het
Lrp2 T G 2: 69,521,787 Q635P probably damaging Het
Mboat2 T C 12: 24,948,382 probably null Het
Mctp1 A G 13: 76,806,259 T596A probably benign Het
Mroh9 T A 1: 163,060,682 M275L probably benign Het
Ms4a10 A C 19: 10,967,505 probably null Het
Myo9a C T 9: 59,815,334 R560C probably damaging Het
Olfr1348 T A 7: 6,501,821 H135L probably damaging Het
Olfr1461 A G 19: 13,165,415 T134A probably benign Het
Olfr747 A G 14: 50,681,259 I125T probably damaging Het
Ormdl3 A G 11: 98,583,982 V45A possibly damaging Het
Parp4 T C 14: 56,620,592 Y894H probably benign Het
Pigo G A 4: 43,023,380 Q259* probably null Het
Prrc2a G A 17: 35,161,827 P70S unknown Het
Rab3ip A G 10: 116,937,536 I124T probably benign Het
Rap1b A G 10: 117,818,479 I21T probably benign Het
Rasgrf2 T A 13: 91,983,613 S642C probably damaging Het
Rb1 T C 14: 73,298,099 E106G probably benign Het
Reps1 C A 10: 18,107,689 R427S probably damaging Het
Rnf213 A C 11: 119,479,655 H4760P possibly damaging Het
Rtl1 A G 12: 109,593,161 I748T probably damaging Het
Sco1 A T 11: 67,053,857 K102M probably damaging Het
Sec16b T C 1: 157,534,711 M44T possibly damaging Het
Slc7a10 T C 7: 35,198,714 M297T probably damaging Het
Smchd1 T C 17: 71,349,667 H1935R probably benign Het
Sowaha G A 11: 53,479,223 R229W probably damaging Het
Sptlc3 A T 2: 139,537,688 M83L probably benign Het
Tbc1d9 T C 8: 83,241,563 V431A probably benign Het
Tmem98 A G 11: 80,821,388 E217G possibly damaging Het
Trim13 T A 14: 61,605,113 L193* probably null Het
Trp53bp2 T C 1: 182,442,735 S367P probably benign Het
Tsc2 T G 17: 24,626,739 I202L probably damaging Het
Twf2 T A 9: 106,214,880 V312E probably damaging Het
Usp34 G T 11: 23,361,622 L471F probably damaging Het
Vps37c A G 19: 10,706,268 D18G probably damaging Het
Other mutations in Alox12b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00959:Alox12b APN 11 69166243 missense probably damaging 1.00
IGL02990:Alox12b APN 11 69163206 missense probably benign 0.17
IGL03106:Alox12b APN 11 69168876 nonsense probably null
R0126:Alox12b UTSW 11 69167471 missense probably benign 0.36
R0135:Alox12b UTSW 11 69162748 missense probably benign 0.06
R0305:Alox12b UTSW 11 69167379 missense probably benign 0.25
R0432:Alox12b UTSW 11 69169556 missense probably damaging 1.00
R0828:Alox12b UTSW 11 69166306 missense possibly damaging 0.89
R0854:Alox12b UTSW 11 69164476 critical splice donor site probably null
R1139:Alox12b UTSW 11 69164405 missense probably damaging 1.00
R1558:Alox12b UTSW 11 69165885 missense probably damaging 1.00
R1870:Alox12b UTSW 11 69158373 missense possibly damaging 0.94
R4088:Alox12b UTSW 11 69158385 missense probably benign 0.14
R4195:Alox12b UTSW 11 69169600 missense probably benign 0.02
R4248:Alox12b UTSW 11 69163605 missense probably benign
R4371:Alox12b UTSW 11 69169616 missense possibly damaging 0.86
R4774:Alox12b UTSW 11 69163207 missense probably benign 0.00
R5108:Alox12b UTSW 11 69157382 missense probably benign 0.11
R5252:Alox12b UTSW 11 69165936 missense probably damaging 1.00
R5579:Alox12b UTSW 11 69162932 missense probably benign 0.04
R6000:Alox12b UTSW 11 69169568 missense probably damaging 0.98
R6168:Alox12b UTSW 11 69169634 missense probably damaging 1.00
R6322:Alox12b UTSW 11 69158373 missense possibly damaging 0.94
R6634:Alox12b UTSW 11 69168821 nonsense probably null
X0018:Alox12b UTSW 11 69157299 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGACTGCTCCATCACTGAC -3'
(R):5'- GGAGCCCACAGTGTTAGAGTTG -3'

Sequencing Primer
(F):5'- ATCACTGACTGCTCCATCAC -3'
(R):5'- CCCACAGTGTTAGAGTTGTCCTTG -3'
Posted On2019-05-13