Incidental Mutation 'R7026:Rtl1'
ID545986
Institutional Source Beutler Lab
Gene Symbol Rtl1
Ensembl Gene ENSMUSG00000085925
Gene Nameretrotransposon Gaglike 1
SynonymsMart1, Mor1, Mar
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7026 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location109589193-109600330 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 109593161 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 748 (I748T)
Ref Sequence ENSEMBL: ENSMUSP00000115957 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000149046]
Predicted Effect probably damaging
Transcript: ENSMUST00000149046
AA Change: I748T

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000115957
Gene: ENSMUSG00000085925
AA Change: I748T

DomainStartEndE-ValueType
low complexity region 19 30 N/A INTRINSIC
low complexity region 41 80 N/A INTRINSIC
internal_repeat_1 88 163 8.8e-50 PROSPERO
internal_repeat_1 176 251 8.8e-50 PROSPERO
low complexity region 332 361 N/A INTRINSIC
low complexity region 380 391 N/A INTRINSIC
low complexity region 393 408 N/A INTRINSIC
Pfam:DUF4939 432 538 1.6e-14 PFAM
Pfam:Retrotrans_gag 493 586 9.2e-13 PFAM
low complexity region 611 632 N/A INTRINSIC
Pfam:gag-asp_proteas 663 731 2.3e-15 PFAM
low complexity region 833 849 N/A INTRINSIC
low complexity region 878 892 N/A INTRINSIC
PDB:4OL8|E 988 1192 6e-17 PDB
Blast:CYCc 989 1158 5e-9 BLAST
SCOP:d1sig__ 1291 1443 2e-4 SMART
low complexity region 1733 1744 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a retrotransposon-derived, paternally expressed imprinted gene that is highly expressed at the late fetal stage in both the fetus and placenta. It has an overlapping maternally expressed antisense transcript, which contains several microRNAs targeting the transcripts of this gene through an RNA interference (RNAi) mechanism. This gene is essential for maintenance of the fetal capillaries. [provided by RefSeq, Jul 2009]
PHENOTYPE: Mice heterozygous for a paternally inherited knock-out allele exhibit fetal/neonatal lethality associated with underdevelopment of the placenta. Mice heteroygous for a maternally inherited knock-out allele exhibit neonatal lethality and decreased survival associated with placental overdevelopment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 A T 19: 43,816,953 M749L probably benign Het
Abcc2 A G 19: 43,830,535 N1321S probably benign Het
Acsm2 T A 7: 119,592,227 V506E probably damaging Het
Add2 G A 6: 86,086,983 R88Q probably benign Het
Adgra3 A G 5: 49,960,741 V1155A probably benign Het
Ahsg T A 16: 22,892,213 D33E probably damaging Het
Alox12b A T 11: 69,157,305 D20V possibly damaging Het
Alppl2 A G 1: 87,089,698 probably null Het
Ankfn1 A G 11: 89,639,577 *49Q probably null Het
Bcl11b T C 12: 107,916,592 D488G probably damaging Het
Bcl2l10 T A 9: 75,351,082 F175L probably benign Het
C2cd3 T A 7: 100,432,092 D127E probably damaging Het
Cacna1c C T 6: 118,637,771 V1311I probably damaging Het
Cd55b A T 1: 130,388,690 I374K probably benign Het
Cfap36 T C 11: 29,222,565 T267A probably benign Het
Cog1 T C 11: 113,649,589 L10P probably damaging Het
Dnah7a T A 1: 53,504,289 M2241L probably benign Het
Dock10 G T 1: 80,501,787 A1809E probably benign Het
Dock7 A T 4: 99,078,919 D255E probably benign Het
Exph5 T C 9: 53,340,428 F123L probably benign Het
Fam92b G A 8: 120,168,585 H193Y probably damaging Het
Fbxw27 C A 9: 109,788,078 K118N possibly damaging Het
Fscb C A 12: 64,471,617 S1025I unknown Het
Get4 C T 5: 139,252,603 R47W possibly damaging Het
Gm14409 T A 2: 177,265,568 I46F probably benign Het
Gm3676 G A 14: 41,644,115 S81F probably benign Het
Gulp1 C T 1: 44,781,085 P251S possibly damaging Het
Hhatl T C 9: 121,788,273 D298G probably benign Het
Hsf2bp T A 17: 32,033,280 K60N possibly damaging Het
Ints4 T A 7: 97,519,154 V625D possibly damaging Het
Iqch T A 9: 63,525,139 K286* probably null Het
Irak1bp1 T A 9: 82,830,031 S2T possibly damaging Het
Kdm3b G A 18: 34,822,464 V1135I possibly damaging Het
Lama3 C A 18: 12,516,548 N181K probably damaging Het
Lrfn2 T G 17: 49,096,977 S709R probably benign Het
Lrp12 T C 15: 39,880,170 H123R probably damaging Het
Lrp1b A G 2: 41,269,222 S1569P probably damaging Het
Lrp2 T G 2: 69,521,787 Q635P probably damaging Het
Mboat2 T C 12: 24,948,382 probably null Het
Mctp1 A G 13: 76,806,259 T596A probably benign Het
Mroh9 T A 1: 163,060,682 M275L probably benign Het
Ms4a10 A C 19: 10,967,505 probably null Het
Myo9a C T 9: 59,815,334 R560C probably damaging Het
Olfr1348 T A 7: 6,501,821 H135L probably damaging Het
Olfr1461 A G 19: 13,165,415 T134A probably benign Het
Olfr747 A G 14: 50,681,259 I125T probably damaging Het
Ormdl3 A G 11: 98,583,982 V45A possibly damaging Het
Parp4 T C 14: 56,620,592 Y894H probably benign Het
Pigo G A 4: 43,023,380 Q259* probably null Het
Prrc2a G A 17: 35,161,827 P70S unknown Het
Rab3ip A G 10: 116,937,536 I124T probably benign Het
Rap1b A G 10: 117,818,479 I21T probably benign Het
Rasgrf2 T A 13: 91,983,613 S642C probably damaging Het
Rb1 T C 14: 73,298,099 E106G probably benign Het
Reps1 C A 10: 18,107,689 R427S probably damaging Het
Rnf213 A C 11: 119,479,655 H4760P possibly damaging Het
Sco1 A T 11: 67,053,857 K102M probably damaging Het
Sec16b T C 1: 157,534,711 M44T possibly damaging Het
Slc7a10 T C 7: 35,198,714 M297T probably damaging Het
Smchd1 T C 17: 71,349,667 H1935R probably benign Het
Sowaha G A 11: 53,479,223 R229W probably damaging Het
Sptlc3 A T 2: 139,537,688 M83L probably benign Het
Tbc1d9 T C 8: 83,241,563 V431A probably benign Het
Tmem98 A G 11: 80,821,388 E217G possibly damaging Het
Trim13 T A 14: 61,605,113 L193* probably null Het
Trp53bp2 T C 1: 182,442,735 S367P probably benign Het
Tsc2 T G 17: 24,626,739 I202L probably damaging Het
Twf2 T A 9: 106,214,880 V312E probably damaging Het
Usp34 G T 11: 23,361,622 L471F probably damaging Het
Vps37c A G 19: 10,706,268 D18G probably damaging Het
Other mutations in Rtl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Rtl1 APN 12 109593000 missense probably benign 0.00
IGL01981:Rtl1 APN 12 109591935 missense possibly damaging 0.72
IGL02418:Rtl1 APN 12 109590449 missense probably damaging 1.00
IGL03164:Rtl1 APN 12 109592933 missense probably damaging 1.00
FR4304:Rtl1 UTSW 12 109591198 small deletion probably benign
R0109:Rtl1 UTSW 12 109595407 start gained probably benign
R0141:Rtl1 UTSW 12 109592948 missense probably damaging 1.00
R0312:Rtl1 UTSW 12 109590227 missense probably damaging 0.99
R0389:Rtl1 UTSW 12 109590363 missense possibly damaging 0.77
R0390:Rtl1 UTSW 12 109591386 missense unknown
R0548:Rtl1 UTSW 12 109591655 missense probably damaging 0.98
R0561:Rtl1 UTSW 12 109593929 missense probably damaging 0.99
R0624:Rtl1 UTSW 12 109592719 missense probably damaging 0.97
R0746:Rtl1 UTSW 12 109592960 missense probably damaging 1.00
R1353:Rtl1 UTSW 12 109592199 missense probably benign 0.00
R1868:Rtl1 UTSW 12 109590536 missense probably damaging 1.00
R1935:Rtl1 UTSW 12 109591920 missense probably benign 0.42
R2000:Rtl1 UTSW 12 109593887 missense probably damaging 1.00
R2094:Rtl1 UTSW 12 109591397 missense unknown
R2125:Rtl1 UTSW 12 109593921 missense possibly damaging 0.64
R2166:Rtl1 UTSW 12 109590554 missense probably damaging 1.00
R2247:Rtl1 UTSW 12 109594979 missense possibly damaging 0.77
R2274:Rtl1 UTSW 12 109594667 missense unknown
R2919:Rtl1 UTSW 12 109591148 missense unknown
R2998:Rtl1 UTSW 12 109595096 missense probably damaging 0.99
R4554:Rtl1 UTSW 12 109594328 missense possibly damaging 0.53
R4566:Rtl1 UTSW 12 109592859 missense probably damaging 1.00
R4887:Rtl1 UTSW 12 109591704 missense probably damaging 0.96
R5399:Rtl1 UTSW 12 109590302 missense probably damaging 1.00
R5512:Rtl1 UTSW 12 109591371 missense unknown
R5616:Rtl1 UTSW 12 109592739 missense unknown
R5644:Rtl1 UTSW 12 109591579 missense probably benign 0.03
R5647:Rtl1 UTSW 12 109594679 missense unknown
R5695:Rtl1 UTSW 12 109594097 missense probably damaging 1.00
R5714:Rtl1 UTSW 12 109593680 missense probably damaging 0.99
R5786:Rtl1 UTSW 12 109592619 missense possibly damaging 0.89
R5917:Rtl1 UTSW 12 109591653 missense possibly damaging 0.82
R5948:Rtl1 UTSW 12 109590599 missense possibly damaging 0.86
R6051:Rtl1 UTSW 12 109593024 missense probably damaging 1.00
R6251:Rtl1 UTSW 12 109593649 missense probably benign 0.16
R6342:Rtl1 UTSW 12 109592301 missense possibly damaging 0.50
R6433:Rtl1 UTSW 12 109595196 missense unknown
R6815:Rtl1 UTSW 12 109594503 missense probably damaging 0.98
R6968:Rtl1 UTSW 12 109594679 missense unknown
R7002:Rtl1 UTSW 12 109593947 missense probably damaging 0.97
R7020:Rtl1 UTSW 12 109592315 missense possibly damaging 0.72
R7027:Rtl1 UTSW 12 109591414 small deletion probably benign
R7196:Rtl1 UTSW 12 109592787 missense possibly damaging 0.83
R7239:Rtl1 UTSW 12 109592475 missense probably benign 0.05
R7312:Rtl1 UTSW 12 109595238 missense unknown
Z1088:Rtl1 UTSW 12 109592319 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GGAAGTCTCATCATCTGCCTC -3'
(R):5'- TGGATGAGAGGTTTGCCCAG -3'

Sequencing Primer
(F):5'- CAATCCGGGCAGTAGGCTTATG -3'
(R):5'- TTGCCCAGGAACACTATGTG -3'
Posted On2019-05-13