Incidental Mutation 'R7026:Lrp12'
ID545994
Institutional Source Beutler Lab
Gene Symbol Lrp12
Ensembl Gene ENSMUSG00000022305
Gene Namelow density lipoprotein-related protein 12
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.150) question?
Stock #R7026 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location39870589-39943994 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 39880170 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 123 (H123R)
Ref Sequence ENSEMBL: ENSMUSP00000105934 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022916] [ENSMUST00000110305] [ENSMUST00000228575]
Predicted Effect probably damaging
Transcript: ENSMUST00000022916
AA Change: H142R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000022916
Gene: ENSMUSG00000022305
AA Change: H142R

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
CUB 47 159 3.23e-28 SMART
LDLa 167 202 1.27e-11 SMART
LDLa 214 256 1.04e-7 SMART
CUB 259 372 9.88e-24 SMART
LDLa 374 412 2.6e-3 SMART
LDLa 413 450 2.36e-6 SMART
LDLa 451 487 5.1e-11 SMART
low complexity region 630 646 N/A INTRINSIC
low complexity region 653 664 N/A INTRINSIC
low complexity region 708 722 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110305
AA Change: H123R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105934
Gene: ENSMUSG00000022305
AA Change: H123R

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
CUB 28 140 3.23e-28 SMART
LDLa 148 183 1.27e-11 SMART
LDLa 195 237 1.04e-7 SMART
CUB 240 353 9.88e-24 SMART
LDLa 355 393 2.6e-3 SMART
LDLa 394 431 2.36e-6 SMART
LDLa 432 468 5.1e-11 SMART
low complexity region 611 627 N/A INTRINSIC
low complexity region 634 645 N/A INTRINSIC
low complexity region 689 703 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000228575
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the low-density lipoprotein receptor related protein family. The product of this gene is a transmembrane protein that is differentially expressed in many cancer cells. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 A T 19: 43,816,953 M749L probably benign Het
Abcc2 A G 19: 43,830,535 N1321S probably benign Het
Acsm2 T A 7: 119,592,227 V506E probably damaging Het
Add2 G A 6: 86,086,983 R88Q probably benign Het
Adgra3 A G 5: 49,960,741 V1155A probably benign Het
Ahsg T A 16: 22,892,213 D33E probably damaging Het
Alox12b A T 11: 69,157,305 D20V possibly damaging Het
Alppl2 A G 1: 87,089,698 probably null Het
Ankfn1 A G 11: 89,639,577 *49Q probably null Het
Bcl11b T C 12: 107,916,592 D488G probably damaging Het
Bcl2l10 T A 9: 75,351,082 F175L probably benign Het
C2cd3 T A 7: 100,432,092 D127E probably damaging Het
Cacna1c C T 6: 118,637,771 V1311I probably damaging Het
Cd55b A T 1: 130,388,690 I374K probably benign Het
Cfap36 T C 11: 29,222,565 T267A probably benign Het
Cog1 T C 11: 113,649,589 L10P probably damaging Het
Dnah7a T A 1: 53,504,289 M2241L probably benign Het
Dock10 G T 1: 80,501,787 A1809E probably benign Het
Dock7 A T 4: 99,078,919 D255E probably benign Het
Exph5 T C 9: 53,340,428 F123L probably benign Het
Fam92b G A 8: 120,168,585 H193Y probably damaging Het
Fbxw27 C A 9: 109,788,078 K118N possibly damaging Het
Fscb C A 12: 64,471,617 S1025I unknown Het
Get4 C T 5: 139,252,603 R47W possibly damaging Het
Gm14409 T A 2: 177,265,568 I46F probably benign Het
Gm3676 G A 14: 41,644,115 S81F probably benign Het
Gulp1 C T 1: 44,781,085 P251S possibly damaging Het
Hhatl T C 9: 121,788,273 D298G probably benign Het
Hsf2bp T A 17: 32,033,280 K60N possibly damaging Het
Ints4 T A 7: 97,519,154 V625D possibly damaging Het
Iqch T A 9: 63,525,139 K286* probably null Het
Irak1bp1 T A 9: 82,830,031 S2T possibly damaging Het
Kdm3b G A 18: 34,822,464 V1135I possibly damaging Het
Lama3 C A 18: 12,516,548 N181K probably damaging Het
Lrfn2 T G 17: 49,096,977 S709R probably benign Het
Lrp1b A G 2: 41,269,222 S1569P probably damaging Het
Lrp2 T G 2: 69,521,787 Q635P probably damaging Het
Mboat2 T C 12: 24,948,382 probably null Het
Mctp1 A G 13: 76,806,259 T596A probably benign Het
Mroh9 T A 1: 163,060,682 M275L probably benign Het
Ms4a10 A C 19: 10,967,505 probably null Het
Myo9a C T 9: 59,815,334 R560C probably damaging Het
Olfr1348 T A 7: 6,501,821 H135L probably damaging Het
Olfr1461 A G 19: 13,165,415 T134A probably benign Het
Olfr747 A G 14: 50,681,259 I125T probably damaging Het
Ormdl3 A G 11: 98,583,982 V45A possibly damaging Het
Parp4 T C 14: 56,620,592 Y894H probably benign Het
Pigo G A 4: 43,023,380 Q259* probably null Het
Prrc2a G A 17: 35,161,827 P70S unknown Het
Rab3ip A G 10: 116,937,536 I124T probably benign Het
Rap1b A G 10: 117,818,479 I21T probably benign Het
Rasgrf2 T A 13: 91,983,613 S642C probably damaging Het
Rb1 T C 14: 73,298,099 E106G probably benign Het
Reps1 C A 10: 18,107,689 R427S probably damaging Het
Rnf213 A C 11: 119,479,655 H4760P possibly damaging Het
Rtl1 A G 12: 109,593,161 I748T probably damaging Het
Sco1 A T 11: 67,053,857 K102M probably damaging Het
Sec16b T C 1: 157,534,711 M44T possibly damaging Het
Slc7a10 T C 7: 35,198,714 M297T probably damaging Het
Smchd1 T C 17: 71,349,667 H1935R probably benign Het
Sowaha G A 11: 53,479,223 R229W probably damaging Het
Sptlc3 A T 2: 139,537,688 M83L probably benign Het
Tbc1d9 T C 8: 83,241,563 V431A probably benign Het
Tmem98 A G 11: 80,821,388 E217G possibly damaging Het
Trim13 T A 14: 61,605,113 L193* probably null Het
Trp53bp2 T C 1: 182,442,735 S367P probably benign Het
Tsc2 T G 17: 24,626,739 I202L probably damaging Het
Twf2 T A 9: 106,214,880 V312E probably damaging Het
Usp34 G T 11: 23,361,622 L471F probably damaging Het
Vps37c A G 19: 10,706,268 D18G probably damaging Het
Other mutations in Lrp12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01953:Lrp12 APN 15 39878101 missense probably damaging 1.00
IGL02501:Lrp12 APN 15 39877904 missense probably damaging 1.00
IGL02850:Lrp12 APN 15 39878575 missense probably damaging 1.00
IGL03365:Lrp12 APN 15 39872521 missense probably benign
R0010:Lrp12 UTSW 15 39878276 missense probably damaging 1.00
R0047:Lrp12 UTSW 15 39878239 missense probably damaging 1.00
R0416:Lrp12 UTSW 15 39878911 splice site probably benign
R0840:Lrp12 UTSW 15 39876158 missense probably damaging 1.00
R1053:Lrp12 UTSW 15 39877981 missense probably damaging 1.00
R1158:Lrp12 UTSW 15 39878431 missense probably damaging 1.00
R1288:Lrp12 UTSW 15 39878403 missense probably damaging 1.00
R1350:Lrp12 UTSW 15 39878250 nonsense probably null
R1416:Lrp12 UTSW 15 39878623 missense probably damaging 1.00
R1548:Lrp12 UTSW 15 39872506 missense probably damaging 0.99
R1691:Lrp12 UTSW 15 39872265 missense probably damaging 1.00
R1696:Lrp12 UTSW 15 39878361 missense probably damaging 0.99
R2050:Lrp12 UTSW 15 39872589 missense probably damaging 0.99
R2513:Lrp12 UTSW 15 39876111 missense probably damaging 1.00
R3415:Lrp12 UTSW 15 39878282 missense probably damaging 1.00
R3417:Lrp12 UTSW 15 39878282 missense probably damaging 1.00
R4118:Lrp12 UTSW 15 39877965 nonsense probably null
R4167:Lrp12 UTSW 15 39885013 missense probably damaging 1.00
R4214:Lrp12 UTSW 15 39872580 missense probably benign 0.33
R4643:Lrp12 UTSW 15 39872022 missense probably damaging 1.00
R5008:Lrp12 UTSW 15 39878456 missense probably damaging 1.00
R5061:Lrp12 UTSW 15 39878254 missense probably damaging 1.00
R5165:Lrp12 UTSW 15 39872461 missense probably benign
R5910:Lrp12 UTSW 15 39876043 intron probably null
R6038:Lrp12 UTSW 15 39872380 missense probably damaging 0.99
R6038:Lrp12 UTSW 15 39872380 missense probably damaging 0.99
R6047:Lrp12 UTSW 15 39872067 missense probably damaging 1.00
R6351:Lrp12 UTSW 15 39878188 missense probably damaging 1.00
R6392:Lrp12 UTSW 15 39872019 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCATCTGACTCAAGCTTCTAATC -3'
(R):5'- ACATGGCATCTTTATGGACGTTC -3'

Sequencing Primer
(F):5'- AAGCTTCTAATCTTCATCTCAGCTG -3'
(R):5'- GCATCTTTATGGACGTTCTTGTC -3'
Posted On2019-05-13