Incidental Mutation 'R7026:Tsc2'
ID545996
Institutional Source Beutler Lab
Gene Symbol Tsc2
Ensembl Gene ENSMUSG00000002496
Gene Nametuberous sclerosis 2
Synonymstuberin, Nafld
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7026 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location24595816-24632630 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 24626739 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 202 (I202L)
Ref Sequence ENSEMBL: ENSMUSP00000153869 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097373] [ENSMUST00000226284] [ENSMUST00000226398] [ENSMUST00000227607] [ENSMUST00000227745] [ENSMUST00000228412]
Predicted Effect possibly damaging
Transcript: ENSMUST00000097373
AA Change: I202L

PolyPhen 2 Score 0.584 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000094986
Gene: ENSMUSG00000002496
AA Change: I202L

DomainStartEndE-ValueType
Pfam:DUF3384 54 470 4e-103 PFAM
Pfam:Tuberin 555 903 5.9e-149 PFAM
low complexity region 1023 1054 N/A INTRINSIC
low complexity region 1271 1278 N/A INTRINSIC
low complexity region 1310 1328 N/A INTRINSIC
low complexity region 1330 1344 N/A INTRINSIC
low complexity region 1378 1398 N/A INTRINSIC
Pfam:Rap_GAP 1497 1685 1.3e-43 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000226284
AA Change: I202L

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect possibly damaging
Transcript: ENSMUST00000226398
AA Change: I202L

PolyPhen 2 Score 0.584 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000227607
AA Change: I143L

PolyPhen 2 Score 0.584 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000227745
AA Change: I202L

PolyPhen 2 Score 0.263 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000228412
AA Change: I202L

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mutations in this gene lead to tuberous sclerosis complex. Its gene product is believed to be a tumor suppressor and is able to stimulate specific GTPases. The protein associates with hamartin in a cytosolic complex, possibly acting as a chaperone for hamartin. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants exhibit liver hypoplasia, open neural tube, thickened myocardium and die by embryonic day 9.5-12.5. Heterozygotes develop renal cystadenomas, liver hemangiomas (sometimes resulting in fatal bleeding) and lung adenomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 A T 19: 43,816,953 M749L probably benign Het
Abcc2 A G 19: 43,830,535 N1321S probably benign Het
Acsm2 T A 7: 119,592,227 V506E probably damaging Het
Add2 G A 6: 86,086,983 R88Q probably benign Het
Adgra3 A G 5: 49,960,741 V1155A probably benign Het
Ahsg T A 16: 22,892,213 D33E probably damaging Het
Alox12b A T 11: 69,157,305 D20V possibly damaging Het
Alppl2 A G 1: 87,089,698 probably null Het
Ankfn1 A G 11: 89,639,577 *49Q probably null Het
Bcl11b T C 12: 107,916,592 D488G probably damaging Het
Bcl2l10 T A 9: 75,351,082 F175L probably benign Het
C2cd3 T A 7: 100,432,092 D127E probably damaging Het
Cacna1c C T 6: 118,637,771 V1311I probably damaging Het
Cd55b A T 1: 130,388,690 I374K probably benign Het
Cfap36 T C 11: 29,222,565 T267A probably benign Het
Cog1 T C 11: 113,649,589 L10P probably damaging Het
Dnah7a T A 1: 53,504,289 M2241L probably benign Het
Dock10 G T 1: 80,501,787 A1809E probably benign Het
Dock7 A T 4: 99,078,919 D255E probably benign Het
Exph5 T C 9: 53,340,428 F123L probably benign Het
Fam92b G A 8: 120,168,585 H193Y probably damaging Het
Fbxw27 C A 9: 109,788,078 K118N possibly damaging Het
Fscb C A 12: 64,471,617 S1025I unknown Het
Get4 C T 5: 139,252,603 R47W possibly damaging Het
Gm14409 T A 2: 177,265,568 I46F probably benign Het
Gm3676 G A 14: 41,644,115 S81F probably benign Het
Gulp1 C T 1: 44,781,085 P251S possibly damaging Het
Hhatl T C 9: 121,788,273 D298G probably benign Het
Hsf2bp T A 17: 32,033,280 K60N possibly damaging Het
Ints4 T A 7: 97,519,154 V625D possibly damaging Het
Iqch T A 9: 63,525,139 K286* probably null Het
Irak1bp1 T A 9: 82,830,031 S2T possibly damaging Het
Kdm3b G A 18: 34,822,464 V1135I possibly damaging Het
Lama3 C A 18: 12,516,548 N181K probably damaging Het
Lrfn2 T G 17: 49,096,977 S709R probably benign Het
Lrp12 T C 15: 39,880,170 H123R probably damaging Het
Lrp1b A G 2: 41,269,222 S1569P probably damaging Het
Lrp2 T G 2: 69,521,787 Q635P probably damaging Het
Mboat2 T C 12: 24,948,382 probably null Het
Mctp1 A G 13: 76,806,259 T596A probably benign Het
Mroh9 T A 1: 163,060,682 M275L probably benign Het
Ms4a10 A C 19: 10,967,505 probably null Het
Myo9a C T 9: 59,815,334 R560C probably damaging Het
Olfr1348 T A 7: 6,501,821 H135L probably damaging Het
Olfr1461 A G 19: 13,165,415 T134A probably benign Het
Olfr747 A G 14: 50,681,259 I125T probably damaging Het
Ormdl3 A G 11: 98,583,982 V45A possibly damaging Het
Parp4 T C 14: 56,620,592 Y894H probably benign Het
Pigo G A 4: 43,023,380 Q259* probably null Het
Prrc2a G A 17: 35,161,827 P70S unknown Het
Rab3ip A G 10: 116,937,536 I124T probably benign Het
Rap1b A G 10: 117,818,479 I21T probably benign Het
Rasgrf2 T A 13: 91,983,613 S642C probably damaging Het
Rb1 T C 14: 73,298,099 E106G probably benign Het
Reps1 C A 10: 18,107,689 R427S probably damaging Het
Rnf213 A C 11: 119,479,655 H4760P possibly damaging Het
Rtl1 A G 12: 109,593,161 I748T probably damaging Het
Sco1 A T 11: 67,053,857 K102M probably damaging Het
Sec16b T C 1: 157,534,711 M44T possibly damaging Het
Slc7a10 T C 7: 35,198,714 M297T probably damaging Het
Smchd1 T C 17: 71,349,667 H1935R probably benign Het
Sowaha G A 11: 53,479,223 R229W probably damaging Het
Sptlc3 A T 2: 139,537,688 M83L probably benign Het
Tbc1d9 T C 8: 83,241,563 V431A probably benign Het
Tmem98 A G 11: 80,821,388 E217G possibly damaging Het
Trim13 T A 14: 61,605,113 L193* probably null Het
Trp53bp2 T C 1: 182,442,735 S367P probably benign Het
Twf2 T A 9: 106,214,880 V312E probably damaging Het
Usp34 G T 11: 23,361,622 L471F probably damaging Het
Vps37c A G 19: 10,706,268 D18G probably damaging Het
Other mutations in Tsc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Tsc2 APN 17 24608107 missense probably damaging 1.00
IGL00985:Tsc2 APN 17 24597131 missense probably damaging 1.00
IGL01386:Tsc2 APN 17 24613285 missense probably damaging 1.00
IGL01468:Tsc2 APN 17 24621097 missense possibly damaging 0.90
IGL01530:Tsc2 APN 17 24622662 missense possibly damaging 0.76
IGL02390:Tsc2 APN 17 24600453 missense probably damaging 1.00
IGL02398:Tsc2 APN 17 24621729 missense probably damaging 1.00
IGL02741:Tsc2 APN 17 24629969 missense probably damaging 1.00
IGL03191:Tsc2 APN 17 24628054 missense probably damaging 1.00
IGL03372:Tsc2 APN 17 24619470 missense probably damaging 1.00
IGL03412:Tsc2 APN 17 24597068 missense probably damaging 0.98
Twitch UTSW 17 24596742 unclassified probably null
PIT4515001:Tsc2 UTSW 17 24621147 missense probably benign 0.15
R0025:Tsc2 UTSW 17 24631004 splice site probably benign
R0025:Tsc2 UTSW 17 24631004 splice site probably benign
R0138:Tsc2 UTSW 17 24599626 missense possibly damaging 0.65
R0540:Tsc2 UTSW 17 24621712 missense probably damaging 1.00
R0570:Tsc2 UTSW 17 24626727 missense probably damaging 1.00
R0607:Tsc2 UTSW 17 24621712 missense probably damaging 1.00
R0826:Tsc2 UTSW 17 24596958 missense probably benign 0.04
R1430:Tsc2 UTSW 17 24599023 critical splice donor site probably null
R1440:Tsc2 UTSW 17 24614392 missense probably damaging 1.00
R1466:Tsc2 UTSW 17 24608973 missense probably damaging 1.00
R1466:Tsc2 UTSW 17 24608973 missense probably damaging 1.00
R1541:Tsc2 UTSW 17 24631976 missense probably damaging 1.00
R1717:Tsc2 UTSW 17 24597068 missense probably damaging 0.98
R1799:Tsc2 UTSW 17 24604408 missense probably benign
R2030:Tsc2 UTSW 17 24623470 splice site probably benign
R2147:Tsc2 UTSW 17 24621142 missense possibly damaging 0.62
R2888:Tsc2 UTSW 17 24631995 critical splice donor site probably null
R3609:Tsc2 UTSW 17 24622550 missense possibly damaging 0.74
R3610:Tsc2 UTSW 17 24622550 missense possibly damaging 0.74
R3811:Tsc2 UTSW 17 24629037 missense probably benign 0.09
R3895:Tsc2 UTSW 17 24599812 missense probably damaging 1.00
R3962:Tsc2 UTSW 17 24621166 splice site probably benign
R3971:Tsc2 UTSW 17 24623588 missense probably damaging 1.00
R4018:Tsc2 UTSW 17 24625281 missense probably damaging 0.99
R4184:Tsc2 UTSW 17 24632016 missense probably benign 0.43
R4435:Tsc2 UTSW 17 24599713 missense probably benign 0.01
R4437:Tsc2 UTSW 17 24599713 missense probably benign 0.01
R4474:Tsc2 UTSW 17 24597264 missense probably damaging 0.98
R4703:Tsc2 UTSW 17 24604909 missense probably benign 0.13
R4731:Tsc2 UTSW 17 24603275 missense possibly damaging 0.72
R4732:Tsc2 UTSW 17 24603275 missense possibly damaging 0.72
R4733:Tsc2 UTSW 17 24603275 missense possibly damaging 0.72
R4817:Tsc2 UTSW 17 24596742 unclassified probably null
R4890:Tsc2 UTSW 17 24600035 missense probably damaging 1.00
R4922:Tsc2 UTSW 17 24600369 missense probably benign 0.22
R5119:Tsc2 UTSW 17 24603280 missense probably benign 0.00
R5393:Tsc2 UTSW 17 24600396 missense possibly damaging 0.89
R5785:Tsc2 UTSW 17 24599887 unclassified probably null
R5838:Tsc2 UTSW 17 24613216 missense probably benign 0.01
R5857:Tsc2 UTSW 17 24600007 missense probably damaging 0.99
R5911:Tsc2 UTSW 17 24600387 missense possibly damaging 0.63
R5988:Tsc2 UTSW 17 24620766 missense probably damaging 1.00
R6275:Tsc2 UTSW 17 24600420 missense probably benign 0.00
R6290:Tsc2 UTSW 17 24596910 missense probably benign 0.04
R6371:Tsc2 UTSW 17 24626714 missense probably benign 0.00
R6467:Tsc2 UTSW 17 24609127 missense probably benign 0.04
R6577:Tsc2 UTSW 17 24610499 missense probably damaging 1.00
R6728:Tsc2 UTSW 17 24621124 missense probably damaging 1.00
R6918:Tsc2 UTSW 17 24613229 missense probably damaging 1.00
R6995:Tsc2 UTSW 17 24628054 missense probably damaging 1.00
R7136:Tsc2 UTSW 17 24613280 missense probably benign 0.00
R7236:Tsc2 UTSW 17 24623594 missense possibly damaging 0.82
R7243:Tsc2 UTSW 17 24599630 missense probably benign 0.02
R7249:Tsc2 UTSW 17 24607755 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATGCAGAGCACCCAACTGTC -3'
(R):5'- AAGCCATCTTGAGATCTCAGTGG -3'

Sequencing Primer
(F):5'- TGTCCTGACAGTACATGCCTACAG -3'
(R):5'- CATCTTGAGATCTCAGTGGAAGCAG -3'
Posted On2019-05-13