Incidental Mutation 'R7026:Lama3'
ID546001
Institutional Source Beutler Lab
Gene Symbol Lama3
Ensembl Gene ENSMUSG00000024421
Gene Namelaminin, alpha 3
Synonyms[a]3B, nicein, 150kDa
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7026 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location12333819-12583013 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 12516548 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 181 (N181K)
Ref Sequence ENSEMBL: ENSMUSP00000140104 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092070] [ENSMUST00000188815]
Predicted Effect probably damaging
Transcript: ENSMUST00000092070
AA Change: N1787K

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000089703
Gene: ENSMUSG00000024421
AA Change: N1787K

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
LamNT 38 294 1.46e-153 SMART
EGF_Lam 296 350 1.39e-4 SMART
EGF_Lam 353 420 2.66e-10 SMART
EGF_Lam 423 464 3.51e-10 SMART
EGF_Lam 488 530 1.73e-9 SMART
EGF_Lam 533 576 3.81e-11 SMART
EGF_like 579 625 1.82e-1 SMART
EGF_Lam 628 678 5.15e-8 SMART
EGF_Lam 681 725 3.54e-6 SMART
low complexity region 768 781 N/A INTRINSIC
EGF_Lam 1263 1306 3.15e-12 SMART
EGF_Lam 1309 1350 6.3e-3 SMART
EGF_Lam 1353 1399 1.49e-13 SMART
EGF_Lam 1402 1450 8.18e-11 SMART
LamB 1509 1638 4.34e-55 SMART
Pfam:Laminin_EGF 1647 1681 7.9e-5 PFAM
EGF_Lam 1684 1728 2.66e-10 SMART
EGF_Lam 1731 1781 7.81e-8 SMART
Pfam:Laminin_I 1836 2102 2.7e-93 PFAM
low complexity region 2185 2200 N/A INTRINSIC
coiled coil region 2211 2238 N/A INTRINSIC
LamG 2406 2566 1.67e-2 SMART
LamG 2614 2742 1.72e-17 SMART
LamG 2785 2900 3.96e-17 SMART
LamG 3005 3133 1.12e-34 SMART
LamG 3175 3308 3.41e-30 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000188815
AA Change: N181K

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000140104
Gene: ENSMUSG00000024421
AA Change: N181K

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF_Lam 78 122 2.66e-10 SMART
EGF_Lam 125 175 7.81e-8 SMART
Pfam:Laminin_I 230 496 1e-90 PFAM
low complexity region 579 594 N/A INTRINSIC
coiled coil region 605 632 N/A INTRINSIC
LamG 800 960 1.67e-2 SMART
LamG 1008 1136 1.72e-17 SMART
LamG 1179 1294 3.96e-17 SMART
LamG 1399 1527 1.12e-34 SMART
LamG 1569 1702 3.41e-30 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the laminin family of secreted molecules. Laminins are heterotrimeric molecules that consist of alpha, beta, and gamma subunits that assemble through a coiled-coil domain. Laminins are essential for formation and function of the basement membrane and have additional functions in regulating cell migration and mechanical signal transduction. This gene encodes an alpha subunit and is responsive to several epithelial-mesenchymal regulators including keratinocyte growth factor, epidermal growth factor and insulin-like growth factor. Mutations in this gene have been identified as the cause of Herlitz type junctional epidermolysis bullosa and laryngoonychocutaneous syndrome. Alternative splicing and alternative promoter usage result in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for a targeted null mutation develop a lethal blistering phenotype similar to human junctional epidermolysis bullosa, and die 2-3 days after birth from a failure to thrive. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 A T 19: 43,816,953 M749L probably benign Het
Abcc2 A G 19: 43,830,535 N1321S probably benign Het
Acsm2 T A 7: 119,592,227 V506E probably damaging Het
Add2 G A 6: 86,086,983 R88Q probably benign Het
Adgra3 A G 5: 49,960,741 V1155A probably benign Het
Ahsg T A 16: 22,892,213 D33E probably damaging Het
Alox12b A T 11: 69,157,305 D20V possibly damaging Het
Alppl2 A G 1: 87,089,698 probably null Het
Ankfn1 A G 11: 89,639,577 *49Q probably null Het
Bcl11b T C 12: 107,916,592 D488G probably damaging Het
Bcl2l10 T A 9: 75,351,082 F175L probably benign Het
C2cd3 T A 7: 100,432,092 D127E probably damaging Het
Cacna1c C T 6: 118,637,771 V1311I probably damaging Het
Cd55b A T 1: 130,388,690 I374K probably benign Het
Cfap36 T C 11: 29,222,565 T267A probably benign Het
Cog1 T C 11: 113,649,589 L10P probably damaging Het
Dnah7a T A 1: 53,504,289 M2241L probably benign Het
Dock10 G T 1: 80,501,787 A1809E probably benign Het
Dock7 A T 4: 99,078,919 D255E probably benign Het
Exph5 T C 9: 53,340,428 F123L probably benign Het
Fam92b G A 8: 120,168,585 H193Y probably damaging Het
Fbxw27 C A 9: 109,788,078 K118N possibly damaging Het
Fscb C A 12: 64,471,617 S1025I unknown Het
Get4 C T 5: 139,252,603 R47W possibly damaging Het
Gm14409 T A 2: 177,265,568 I46F probably benign Het
Gm3676 G A 14: 41,644,115 S81F probably benign Het
Gulp1 C T 1: 44,781,085 P251S possibly damaging Het
Hhatl T C 9: 121,788,273 D298G probably benign Het
Hsf2bp T A 17: 32,033,280 K60N possibly damaging Het
Ints4 T A 7: 97,519,154 V625D possibly damaging Het
Iqch T A 9: 63,525,139 K286* probably null Het
Irak1bp1 T A 9: 82,830,031 S2T possibly damaging Het
Kdm3b G A 18: 34,822,464 V1135I possibly damaging Het
Lrfn2 T G 17: 49,096,977 S709R probably benign Het
Lrp12 T C 15: 39,880,170 H123R probably damaging Het
Lrp1b A G 2: 41,269,222 S1569P probably damaging Het
Lrp2 T G 2: 69,521,787 Q635P probably damaging Het
Mboat2 T C 12: 24,948,382 probably null Het
Mctp1 A G 13: 76,806,259 T596A probably benign Het
Mroh9 T A 1: 163,060,682 M275L probably benign Het
Myo9a C T 9: 59,815,334 R560C probably damaging Het
Olfr1348 T A 7: 6,501,821 H135L probably damaging Het
Olfr1461 A G 19: 13,165,415 T134A probably benign Het
Olfr747 A G 14: 50,681,259 I125T probably damaging Het
Ormdl3 A G 11: 98,583,982 V45A possibly damaging Het
Parp4 T C 14: 56,620,592 Y894H probably benign Het
Pigo G A 4: 43,023,380 Q259* probably null Het
Prrc2a G A 17: 35,161,827 P70S unknown Het
Rab3ip A G 10: 116,937,536 I124T probably benign Het
Rap1b A G 10: 117,818,479 I21T probably benign Het
Rasgrf2 T A 13: 91,983,613 S642C probably damaging Het
Rb1 T C 14: 73,298,099 E106G probably benign Het
Reps1 C A 10: 18,107,689 R427S probably damaging Het
Rnf213 A C 11: 119,479,655 H4760P possibly damaging Het
Rtl1 A G 12: 109,593,161 I748T probably damaging Het
Sco1 A T 11: 67,053,857 K102M probably damaging Het
Sec16b T C 1: 157,534,711 M44T possibly damaging Het
Slc7a10 T C 7: 35,198,714 M297T probably damaging Het
Smchd1 T C 17: 71,349,667 H1935R probably benign Het
Sowaha G A 11: 53,479,223 R229W probably damaging Het
Sptlc3 A T 2: 139,537,688 M83L probably benign Het
Tbc1d9 T C 8: 83,241,563 V431A probably benign Het
Tmem98 A G 11: 80,821,388 E217G possibly damaging Het
Trim13 T A 14: 61,605,113 L193* probably null Het
Trp53bp2 T C 1: 182,442,735 S367P probably benign Het
Tsc2 T G 17: 24,626,739 I202L probably damaging Het
Twf2 T A 9: 106,214,880 V312E probably damaging Het
Usp34 G T 11: 23,361,622 L471F probably damaging Het
Vps37c A G 19: 10,706,268 D18G probably damaging Het
Other mutations in Lama3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Lama3 APN 18 12580292 missense probably benign
IGL00272:Lama3 APN 18 12491548 missense probably damaging 1.00
IGL00335:Lama3 APN 18 12449588 splice site probably benign
IGL00836:Lama3 APN 18 12472228 missense probably benign 0.01
IGL01017:Lama3 APN 18 12441143 critical splice donor site probably null
IGL01025:Lama3 APN 18 12481037 missense probably benign 0.09
IGL01394:Lama3 APN 18 12531926 missense probably null 0.39
IGL01545:Lama3 APN 18 12441131 missense probably benign 0.01
IGL01685:Lama3 APN 18 12453880 splice site probably benign
IGL01863:Lama3 APN 18 12419936 splice site probably benign
IGL01869:Lama3 APN 18 12524763 missense possibly damaging 0.94
IGL01894:Lama3 APN 18 12572064 missense probably benign 0.09
IGL02027:Lama3 APN 18 12516513 missense probably damaging 1.00
IGL02106:Lama3 APN 18 12468314 missense probably damaging 0.98
IGL02307:Lama3 APN 18 12581783 missense probably benign 0.09
IGL02342:Lama3 APN 18 12491476 missense probably damaging 1.00
IGL02377:Lama3 APN 18 12556750 missense possibly damaging 0.49
IGL02401:Lama3 APN 18 12557727 missense probably benign 0.02
IGL02517:Lama3 APN 18 12537858 critical splice donor site probably null
IGL02644:Lama3 APN 18 12525853 missense probably benign 0.12
IGL02733:Lama3 APN 18 12578127 missense probably damaging 0.99
IGL02932:Lama3 APN 18 12528801 missense probably damaging 1.00
IGL03006:Lama3 APN 18 12468368 splice site probably benign
IGL03038:Lama3 APN 18 12419250 missense probably damaging 0.99
IGL03064:Lama3 APN 18 12439349 missense possibly damaging 0.72
IGL03146:Lama3 APN 18 12527624 missense possibly damaging 0.66
IGL03233:Lama3 APN 18 12481038 missense probably damaging 1.00
IGL03255:Lama3 APN 18 12539703 missense probably damaging 1.00
IGL03369:Lama3 APN 18 12553283 missense probably benign 0.05
IGL03412:Lama3 APN 18 12419182 missense probably damaging 0.99
Camelid UTSW 18 12419257 critical splice donor site probably null
IGL02980:Lama3 UTSW 18 12553231 missense probably benign 0.01
IGL03014:Lama3 UTSW 18 12539967 missense possibly damaging 0.95
R0007:Lama3 UTSW 18 12497881 splice site probably benign
R0007:Lama3 UTSW 18 12497881 splice site probably benign
R0050:Lama3 UTSW 18 12404103 missense probably damaging 1.00
R0050:Lama3 UTSW 18 12404103 missense probably damaging 1.00
R0063:Lama3 UTSW 18 12528705 splice site probably benign
R0063:Lama3 UTSW 18 12528705 splice site probably benign
R0106:Lama3 UTSW 18 12403982 missense probably damaging 0.96
R0148:Lama3 UTSW 18 12448272 missense probably damaging 1.00
R0165:Lama3 UTSW 18 12524810 missense probably damaging 0.99
R0240:Lama3 UTSW 18 12539823 splice site probably null
R0240:Lama3 UTSW 18 12539823 splice site probably null
R0316:Lama3 UTSW 18 12519877 missense probably benign 0.09
R0325:Lama3 UTSW 18 12482126 missense probably damaging 1.00
R0365:Lama3 UTSW 18 12507007 missense probably damaging 0.96
R0390:Lama3 UTSW 18 12407563 missense probably benign 0.10
R0408:Lama3 UTSW 18 12456837 missense probably benign
R0449:Lama3 UTSW 18 12500512 unclassified probably null
R0453:Lama3 UTSW 18 12465478 missense possibly damaging 0.63
R0480:Lama3 UTSW 18 12450424 missense possibly damaging 0.81
R0536:Lama3 UTSW 18 12525894 missense probably damaging 1.00
R0545:Lama3 UTSW 18 12561701 missense possibly damaging 0.90
R0567:Lama3 UTSW 18 12549252 missense probably benign
R0605:Lama3 UTSW 18 12506949 missense probably benign 0.02
R0617:Lama3 UTSW 18 12419258 critical splice donor site probably null
R0629:Lama3 UTSW 18 12419245 missense possibly damaging 0.79
R0671:Lama3 UTSW 18 12477590 missense possibly damaging 0.80
R0730:Lama3 UTSW 18 12456850 splice site probably benign
R1216:Lama3 UTSW 18 12421134 splice site probably benign
R1356:Lama3 UTSW 18 12500577 unclassified probably benign
R1386:Lama3 UTSW 18 12477370 missense probably benign 0.04
R1424:Lama3 UTSW 18 12519991 missense probably benign 0.13
R1426:Lama3 UTSW 18 12481098 critical splice donor site probably null
R1437:Lama3 UTSW 18 12549227 missense possibly damaging 0.46
R1468:Lama3 UTSW 18 12441107 missense probably benign 0.00
R1468:Lama3 UTSW 18 12441107 missense probably benign 0.00
R1472:Lama3 UTSW 18 12482045 missense probably benign 0.23
R1557:Lama3 UTSW 18 12513731 splice site probably benign
R1571:Lama3 UTSW 18 12539717 missense probably damaging 0.98
R1599:Lama3 UTSW 18 12450400 nonsense probably null
R1631:Lama3 UTSW 18 12407494 missense probably damaging 1.00
R1647:Lama3 UTSW 18 12532199 missense possibly damaging 0.90
R1648:Lama3 UTSW 18 12532199 missense possibly damaging 0.90
R1719:Lama3 UTSW 18 12479872 critical splice donor site probably null
R1757:Lama3 UTSW 18 12465499 missense probably benign 0.10
R1766:Lama3 UTSW 18 12402062 missense probably damaging 1.00
R1853:Lama3 UTSW 18 12513705 missense possibly damaging 0.75
R1856:Lama3 UTSW 18 12537781 nonsense probably null
R1909:Lama3 UTSW 18 12581798 missense probably benign 0.19
R1913:Lama3 UTSW 18 12495279 missense probably benign 0.15
R1975:Lama3 UTSW 18 12453863 missense probably damaging 1.00
R2014:Lama3 UTSW 18 12524721 splice site probably benign
R2059:Lama3 UTSW 18 12528333 missense probably damaging 0.98
R2060:Lama3 UTSW 18 12528726 missense probably benign 0.30
R2086:Lama3 UTSW 18 12524830 missense probably benign 0.39
R2115:Lama3 UTSW 18 12402849 missense possibly damaging 0.94
R2291:Lama3 UTSW 18 12525079 missense probably damaging 0.98
R2860:Lama3 UTSW 18 12453750 missense probably damaging 1.00
R2861:Lama3 UTSW 18 12453750 missense probably damaging 1.00
R2862:Lama3 UTSW 18 12453750 missense probably damaging 1.00
R3410:Lama3 UTSW 18 12413858 critical splice donor site probably null
R3614:Lama3 UTSW 18 12448288 missense probably benign 0.03
R3696:Lama3 UTSW 18 12439475 splice site probably benign
R3752:Lama3 UTSW 18 12507029 missense probably damaging 1.00
R3967:Lama3 UTSW 18 12580341 missense probably damaging 1.00
R3968:Lama3 UTSW 18 12580341 missense probably damaging 1.00
R3969:Lama3 UTSW 18 12580341 missense probably damaging 1.00
R3970:Lama3 UTSW 18 12580341 missense probably damaging 1.00
R4088:Lama3 UTSW 18 12504308 nonsense probably null
R4118:Lama3 UTSW 18 12450431 missense probably benign 0.01
R4222:Lama3 UTSW 18 12450403 missense probably damaging 1.00
R4223:Lama3 UTSW 18 12450403 missense probably damaging 1.00
R4224:Lama3 UTSW 18 12450403 missense probably damaging 1.00
R4225:Lama3 UTSW 18 12450403 missense probably damaging 1.00
R4367:Lama3 UTSW 18 12513690 missense probably damaging 1.00
R4404:Lama3 UTSW 18 12582531 missense probably benign 0.01
R4424:Lama3 UTSW 18 12519872 nonsense probably null
R4483:Lama3 UTSW 18 12549253 missense probably benign 0.32
R4484:Lama3 UTSW 18 12481088 missense probably benign
R4516:Lama3 UTSW 18 12495358 missense probably damaging 1.00
R4556:Lama3 UTSW 18 12479759 missense possibly damaging 0.63
R4616:Lama3 UTSW 18 12504397 critical splice donor site probably null
R4702:Lama3 UTSW 18 12578029 nonsense probably null
R4704:Lama3 UTSW 18 12553223 missense probably benign 0.08
R4750:Lama3 UTSW 18 12504359 missense probably benign 0.25
R4753:Lama3 UTSW 18 12482084 missense probably damaging 1.00
R4767:Lama3 UTSW 18 12500563 missense probably benign 0.32
R4777:Lama3 UTSW 18 12413771 missense probably damaging 1.00
R4782:Lama3 UTSW 18 12411570 nonsense probably null
R4784:Lama3 UTSW 18 12449544 missense probably benign 0.20
R4816:Lama3 UTSW 18 12477604 missense possibly damaging 0.93
R4833:Lama3 UTSW 18 12441131 missense probably benign 0.01
R4854:Lama3 UTSW 18 12411542 missense probably benign 0.00
R4863:Lama3 UTSW 18 12498678 intron probably benign
R4863:Lama3 UTSW 18 12539793 missense probably damaging 0.99
R4953:Lama3 UTSW 18 12448305 missense probably damaging 1.00
R4974:Lama3 UTSW 18 12552826 missense probably damaging 0.98
R4996:Lama3 UTSW 18 12518743 missense probably benign 0.24
R5049:Lama3 UTSW 18 12582611 missense probably benign 0.19
R5057:Lama3 UTSW 18 12531948 missense probably null 0.82
R5090:Lama3 UTSW 18 12542402 missense possibly damaging 0.94
R5122:Lama3 UTSW 18 12539766 missense possibly damaging 0.53
R5215:Lama3 UTSW 18 12577900 missense probably damaging 1.00
R5245:Lama3 UTSW 18 12419893 missense probably damaging 1.00
R5259:Lama3 UTSW 18 12465508 missense probably damaging 1.00
R5320:Lama3 UTSW 18 12552855 missense probably damaging 0.99
R5377:Lama3 UTSW 18 12453746 missense probably damaging 0.99
R5432:Lama3 UTSW 18 12572066 missense probably damaging 1.00
R5500:Lama3 UTSW 18 12456764 missense possibly damaging 0.93
R5534:Lama3 UTSW 18 12553210 missense probably benign 0.00
R5589:Lama3 UTSW 18 12472220 missense possibly damaging 0.46
R5604:Lama3 UTSW 18 12439348 missense probably benign
R5617:Lama3 UTSW 18 12498936 intron probably benign
R5709:Lama3 UTSW 18 12539799 missense probably damaging 1.00
R5965:Lama3 UTSW 18 12429887 missense possibly damaging 0.67
R6042:Lama3 UTSW 18 12574254 missense probably damaging 1.00
R6060:Lama3 UTSW 18 12556663 missense probably damaging 0.99
R6065:Lama3 UTSW 18 12469928 missense possibly damaging 0.53
R6085:Lama3 UTSW 18 12482099 missense probably benign 0.01
R6212:Lama3 UTSW 18 12513645 missense probably damaging 1.00
R6268:Lama3 UTSW 18 12524737 missense probably damaging 0.98
R6276:Lama3 UTSW 18 12506949 missense probably benign 0.02
R6366:Lama3 UTSW 18 12482137 missense probably damaging 1.00
R6393:Lama3 UTSW 18 12479756 missense probably benign 0.44
R6493:Lama3 UTSW 18 12482148 critical splice donor site probably null
R6505:Lama3 UTSW 18 12495348 missense probably benign 0.02
R6563:Lama3 UTSW 18 12537766 missense probably damaging 1.00
R6582:Lama3 UTSW 18 12577840 missense probably damaging 1.00
R6585:Lama3 UTSW 18 12419257 critical splice donor site probably null
R6609:Lama3 UTSW 18 12513678 missense probably damaging 0.99
R6656:Lama3 UTSW 18 12549226 missense possibly damaging 0.66
R6833:Lama3 UTSW 18 12491548 missense probably damaging 1.00
R6834:Lama3 UTSW 18 12491548 missense probably damaging 1.00
R7019:Lama3 UTSW 18 12528418 missense probably damaging 0.97
R7088:Lama3 UTSW 18 12582545 missense possibly damaging 0.90
R7100:Lama3 UTSW 18 12582644 missense possibly damaging 0.80
R7102:Lama3 UTSW 18 12552813 missense possibly damaging 0.66
R7103:Lama3 UTSW 18 12531879 missense probably benign 0.00
R7121:Lama3 UTSW 18 12462782 missense probably benign 0.06
R7133:Lama3 UTSW 18 12539786 missense probably benign 0.05
R7150:Lama3 UTSW 18 12468289 missense probably damaging 1.00
X0019:Lama3 UTSW 18 12582574 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TGAAATGTTCGTCCTCGCCAG -3'
(R):5'- GGCTCACTGGGGTTTTAAAAC -3'

Sequencing Primer
(F):5'- TCGCCAGCCTGTGTCAC -3'
(R):5'- AACGTAATTGAAGTAATGATCCCTCG -3'
Posted On2019-05-13